HUGE

Gene/Protein Characteristic Table for KIAA1132

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00183
Accession No. :	AB032958
Description :	Down syndrome cell adhesion molecule-like protein 1 precursor.
HUGO Gene Name :	Down syndrome cell adhesion molecule like 1 (DSCAML1)
Clone Name :	hh01132s1 [Vector Info]
Flexi ORF Clone :	pF1KA1132
Source :	Human adult brain
Note :	We replaced hh01132, former representative clones for KIAA1132 with hh01132s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6834 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 555 bp

Genome contig ID gi51511727r_116703699
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GACCCAGCGCCGTGTGCAATAAAGGTTATGTTTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTGGTGGCTTTTTTCCCATCTGGCGAAGGCCAGCGGGGAGGGAGGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 116803699 117173121 33 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2092 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM09558	100.0	Down syndrome c...	Homo sapiens
XP_001158737	99.8	Down syndrome c...	Pan troglodytes
NP_001074739	98.2	Down syndrome c...	Mus musculus
EDL95372	98.1	Down syndrome c...	Rattus norvegicus
AAL57166	100.0	Down syndrome c...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040929	2.9e-12	24.8	KIAA1496
AB046788	2.4e-10	27.5	KIAA1568
AB018299	5.6e-09	24.2	KIAA0756
AB040947	4.4e-06	27.2	KIAA1514
AB037776	4.3e-05	23.7	KIAA1355

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013098 265 350 PF07679 Immunoglobulin I-set

IPR013151 368 427 PF00047 Immunoglobulin

IPR013098 447 541 PF07679 Immunoglobulin I-set

IPR013151 558 616 PF00047 Immunoglobulin

IPR013151 649 710 PF00047 Immunoglobulin

IPR013098 729 824 PF07679 Immunoglobulin I-set

IPR013151 842 908 PF00047 Immunoglobulin

IPR003961 926 1013 PF00041 Fibronectin

IPR003961 1025 1117 PF00041 Fibronectin

IPR003961 1129 1218 PF00041 Fibronectin

IPR003961 1230 1316 PF00041 Fibronectin

IPR013098 1329 1419 PF07679 Immunoglobulin I-set

IPR003961 1423 1506 PF00041 Fibronectin

IPR003961 1520 1602 PF00041 Fibronectin

HMMSmart IPR003599 71 161 SM00409 Immunoglobulin subtype

IPR003598 77 149 SM00408 Immunoglobulin subtype 2

IPR003599 170 258 SM00409 Immunoglobulin subtype

IPR003599 271 351 SM00409 Immunoglobulin subtype

IPR003598 277 340 SM00408 Immunoglobulin subtype 2

IPR003596 281 335 SM00406 Immunoglobulin V-set

IPR003599 360 442 SM00409 Immunoglobulin subtype

IPR003598 366 432 SM00408 Immunoglobulin subtype 2

IPR003599 453 542 SM00409 Immunoglobulin subtype

IPR003598 459 531 SM00408 Immunoglobulin subtype 2

IPR003599 550 633 SM00409 Immunoglobulin subtype

IPR003598 556 621 SM00408 Immunoglobulin subtype 2

IPR003599 641 726 SM00409 Immunoglobulin subtype

IPR003598 647 715 SM00408 Immunoglobulin subtype 2

IPR003599 735 825 SM00409 Immunoglobulin subtype

IPR003598 741 813 SM00408 Immunoglobulin subtype 2

IPR003599 834 924 SM00409 Immunoglobulin subtype

IPR003598 840 913 SM00408 Immunoglobulin subtype 2

IPR003961 926 1010 SM00060 Fibronectin

IPR003961 1026 1114 SM00060 Fibronectin

IPR003961 1129 1215 SM00060 Fibronectin

IPR003961 1230 1313 SM00060 Fibronectin

IPR003599 1338 1420 SM00409 Immunoglobulin subtype

IPR003598 1344 1409 SM00408 Immunoglobulin subtype 2

IPR003596 1345 1404 SM00406 Immunoglobulin V-set

IPR003961 1423 1503 SM00060 Fibronectin

IPR003961 1518 1599 SM00060 Fibronectin

ProfileScan IPR007110 57 146 PS50835 Immunoglobulin-like

IPR007110 154 256 PS50835 Immunoglobulin-like

IPR007110 265 345 PS50835 Immunoglobulin-like

IPR007110 353 441 PS50835 Immunoglobulin-like

IPR007110 447 540 PS50835 Immunoglobulin-like

IPR007110 545 625 PS50835 Immunoglobulin-like

IPR007110 635 724 PS50835 Immunoglobulin-like

IPR007110 729 823 PS50835 Immunoglobulin-like

IPR007110 827 924 PS50835 Immunoglobulin-like

IPR003961 926 1019 PS50853 Fibronectin

IPR003961 1025 1124 PS50853 Fibronectin

IPR003961 1129 1225 PS50853 Fibronectin

IPR003961 1230 1322 PS50853 Fibronectin

IPR007110 1317 1416 PS50835 Immunoglobulin-like

IPR003961 1419 1513 PS50853 Fibronectin

IPR003961 1518 1608 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	265	350	PF07679	Immunoglobulin I-set
IPR013151	368	427	PF00047	Immunoglobulin
IPR013098	447	541	PF07679	Immunoglobulin I-set
IPR013151	558	616	PF00047	Immunoglobulin
IPR013151	649	710	PF00047	Immunoglobulin
IPR013098	729	824	PF07679	Immunoglobulin I-set
IPR013151	842	908	PF00047	Immunoglobulin
IPR003961	926	1013	PF00041	Fibronectin
IPR003961	1025	1117	PF00041	Fibronectin
IPR003961	1129	1218	PF00041	Fibronectin
IPR003961	1230	1316	PF00041	Fibronectin
IPR013098	1329	1419	PF07679	Immunoglobulin I-set
IPR003961	1423	1506	PF00041	Fibronectin
IPR003961	1520	1602	PF00041	Fibronectin
HMMSmart	IPR003599	71	161	SM00409	Immunoglobulin subtype
IPR003598	77	149	SM00408	Immunoglobulin subtype 2
IPR003599	170	258	SM00409	Immunoglobulin subtype
IPR003599	271	351	SM00409	Immunoglobulin subtype
IPR003598	277	340	SM00408	Immunoglobulin subtype 2
IPR003596	281	335	SM00406	Immunoglobulin V-set
IPR003599	360	442	SM00409	Immunoglobulin subtype
IPR003598	366	432	SM00408	Immunoglobulin subtype 2
IPR003599	453	542	SM00409	Immunoglobulin subtype
IPR003598	459	531	SM00408	Immunoglobulin subtype 2
IPR003599	550	633	SM00409	Immunoglobulin subtype
IPR003598	556	621	SM00408	Immunoglobulin subtype 2
IPR003599	641	726	SM00409	Immunoglobulin subtype
IPR003598	647	715	SM00408	Immunoglobulin subtype 2
IPR003599	735	825	SM00409	Immunoglobulin subtype
IPR003598	741	813	SM00408	Immunoglobulin subtype 2
IPR003599	834	924	SM00409	Immunoglobulin subtype
IPR003598	840	913	SM00408	Immunoglobulin subtype 2
IPR003961	926	1010	SM00060	Fibronectin
IPR003961	1026	1114	SM00060	Fibronectin
IPR003961	1129	1215	SM00060	Fibronectin
IPR003961	1230	1313	SM00060	Fibronectin
IPR003599	1338	1420	SM00409	Immunoglobulin subtype
IPR003598	1344	1409	SM00408	Immunoglobulin subtype 2
IPR003596	1345	1404	SM00406	Immunoglobulin V-set
IPR003961	1423	1503	SM00060	Fibronectin
IPR003961	1518	1599	SM00060	Fibronectin
ProfileScan	IPR007110	57	146	PS50835	Immunoglobulin-like
IPR007110	154	256	PS50835	Immunoglobulin-like
IPR007110	265	345	PS50835	Immunoglobulin-like
IPR007110	353	441	PS50835	Immunoglobulin-like
IPR007110	447	540	PS50835	Immunoglobulin-like
IPR007110	545	625	PS50835	Immunoglobulin-like
IPR007110	635	724	PS50835	Immunoglobulin-like
IPR007110	729	823	PS50835	Immunoglobulin-like
IPR007110	827	924	PS50835	Immunoglobulin-like
IPR003961	926	1019	PS50853	Fibronectin
IPR003961	1025	1124	PS50853	Fibronectin
IPR003961	1129	1225	PS50853	Fibronectin
IPR003961	1230	1322	PS50853	Fibronectin
IPR007110	1317	1416	PS50835	Immunoglobulin-like
IPR003961	1419	1513	PS50853	Fibronectin
IPR003961	1518	1608	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 34 IGPLYGMWLVTFLLLLDSLHK 54 SECONDARY 21

2 1631 LFTIGCPVILATLGVALLFIV 1651 PRIMARY 21

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	34	IGPLYGMWLVTFLLLLDSLHK	54	SECONDARY	21
2	1631	LFTIGCPVILATLGVALLFIV	1651	PRIMARY	21

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAAAATCCCAACTCAGAGAC

Primer_r
: AACCTTTATTGCACACGGCGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCAAGAAGTTCGCCCAGTATG
Primer_r	: TTGAGGACGCCATTGAGGGTG
PCR product length	: 205(3.0k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	555 bp
Genome contig ID	gi51511727r_116703699
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GACCCAGCGCCGTGTGCAATAAAGGTTATGTTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGGTGGCTTTTTTCCCATCTGGCGAAGGCCAGCGGGGAGGGAGGAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	116803699	117173121	33	99.8	Perfect prediction

Primer_f	: CCAAAATCCCAACTCAGAGAC
Primer_r	: AACCTTTATTGCACACGGCGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1132

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information