HUGE |
Gene/Protein Characteristic Table for KIAA0756 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01119 |
---|---|
Accession No. : | AB018299 |
Description : | Neurofascin precursor. |
HUGO Gene Name : | neurofascin homolog (chicken) (NFASC) |
Clone Name : | ff01911 [Vector Info] |
Flexi ORF Clone : | pF1KA0756
![]() |
Source : | Human fetal brain |
Note : | We replaced hk04562 and fh00384, former representative clones for KIAA0756 with ff01911. (2002/5/10,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9959 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 6290 bp Genome contig ID gi89161185f_203056423 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AACACTAAACGTATAATAAAAGTTGTTCAAAATGGFlanking genome sequence
(202151 - 202200) ----+----*----+----*----+----*----+----*----+----*
ACTCTTGCCATGTGATTTGCTCATTTTCTTGATTTGTTCCTGTTGGTAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 203156423 203258572 26 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1222 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGCACCCCAATACAGAACATC | |
: TGAGAGCCCTAAGTGAAATTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: TGCACCCCAATACAGAACATC | |
: TGAGAGCCCTAAGTGAAATTC | |
: 162 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |