HUGE

Gene/Protein Characteristic Table for KIAA0756

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01119
Accession No. :	AB018299
Description :	Neurofascin precursor.
HUGO Gene Name :	neurofascin homolog (chicken) (NFASC)
Clone Name :	ff01911 [Vector Info]
Flexi ORF Clone :	pF1KA0756
Source :	Human fetal brain
Note :	We replaced hk04562 and fh00384, former representative clones for KIAA0756 with ff01911. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 9959 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 6290 bp

Genome contig ID gi89161185f_203056423
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AACACTAAACGTATAATAAAAGTTGTTCAAAATGG
Flanking genome sequence
(202151 - 202200)
----+----*----+----*----+----*----+----*----+----*
ACTCTTGCCATGTGATTTGCTCATTTTCTTGATTTGTTCCTGTTGGTAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 203156423 203258572 26 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_514129	99.5	neurofascin [Pa...	Pan troglodytes
XP_001097065	96.7	similar to neur...	Macaca mulatta
XP_856076	95.8	similar to neur...	Canis lupus fam...
BAG10378	100.0	neurofascin pre...	synthetic construct
CAI14658	99.6	neurofascin hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002341	1.5e-68	51.2	KIAA0343
AB040947	3.9e-34	26.1	KIAA1514
AB040929	2.1e-33	28.2	KIAA1496
AB032958	4.8e-23	23.9	KIAA1132
AB037776	2.7e-18	25.3	KIAA1355

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013098 88 183 PF07679 Immunoglobulin I-set

IPR013151 202 262 PF00047 Immunoglobulin

IPR013098 308 397 PF07679 Immunoglobulin I-set

IPR013098 401 489 PF07679 Immunoglobulin I-set

IPR013098 494 582 PF07679 Immunoglobulin I-set

IPR013098 586 673 PF07679 Immunoglobulin I-set

IPR003961 677 763 PF00041 Fibronectin

IPR003961 776 862 PF00041 Fibronectin

IPR003961 874 969 PF00041 Fibronectin

IPR003961 981 1068 PF00041 Fibronectin

HMMSmart IPR003599 95 184 SM00409 Immunoglobulin subtype

IPR003598 101 172 SM00408 Immunoglobulin subtype 2

IPR003599 194 281 SM00409 Immunoglobulin subtype

IPR003598 200 267 SM00408 Immunoglobulin subtype 2

IPR003599 317 398 SM00409 Immunoglobulin subtype

IPR003598 323 387 SM00408 Immunoglobulin subtype 2

IPR003599 407 490 SM00409 Immunoglobulin subtype

IPR003598 413 479 SM00408 Immunoglobulin subtype 2

IPR003599 501 583 SM00409 Immunoglobulin subtype

IPR003598 507 572 SM00408 Immunoglobulin subtype 2

IPR003599 592 674 SM00409 Immunoglobulin subtype

IPR003598 598 663 SM00408 Immunoglobulin subtype 2

IPR003961 677 760 SM00060 Fibronectin

IPR003961 777 859 SM00060 Fibronectin

IPR003961 875 966 SM00060 Fibronectin

IPR003961 981 1065 SM00060 Fibronectin

ProfileScan IPR007110 88 184 PS50835 Immunoglobulin-like

IPR007110 190 277 PS50835 Immunoglobulin-like

IPR007110 308 396 PS50835 Immunoglobulin-like

IPR007110 401 488 PS50835 Immunoglobulin-like

IPR007110 493 581 PS50835 Immunoglobulin-like

IPR007110 585 667 PS50835 Immunoglobulin-like

IPR003961 677 769 PS50853 Fibronectin

IPR003961 776 869 PS50853 Fibronectin

IPR003961 874 976 PS50853 Fibronectin

IPR003961 981 1074 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	88	183	PF07679	Immunoglobulin I-set
IPR013151	202	262	PF00047	Immunoglobulin
IPR013098	308	397	PF07679	Immunoglobulin I-set
IPR013098	401	489	PF07679	Immunoglobulin I-set
IPR013098	494	582	PF07679	Immunoglobulin I-set
IPR013098	586	673	PF07679	Immunoglobulin I-set
IPR003961	677	763	PF00041	Fibronectin
IPR003961	776	862	PF00041	Fibronectin
IPR003961	874	969	PF00041	Fibronectin
IPR003961	981	1068	PF00041	Fibronectin
HMMSmart	IPR003599	95	184	SM00409	Immunoglobulin subtype
IPR003598	101	172	SM00408	Immunoglobulin subtype 2
IPR003599	194	281	SM00409	Immunoglobulin subtype
IPR003598	200	267	SM00408	Immunoglobulin subtype 2
IPR003599	317	398	SM00409	Immunoglobulin subtype
IPR003598	323	387	SM00408	Immunoglobulin subtype 2
IPR003599	407	490	SM00409	Immunoglobulin subtype
IPR003598	413	479	SM00408	Immunoglobulin subtype 2
IPR003599	501	583	SM00409	Immunoglobulin subtype
IPR003598	507	572	SM00408	Immunoglobulin subtype 2
IPR003599	592	674	SM00409	Immunoglobulin subtype
IPR003598	598	663	SM00408	Immunoglobulin subtype 2
IPR003961	677	760	SM00060	Fibronectin
IPR003961	777	859	SM00060	Fibronectin
IPR003961	875	966	SM00060	Fibronectin
IPR003961	981	1065	SM00060	Fibronectin
ProfileScan	IPR007110	88	184	PS50835	Immunoglobulin-like
IPR007110	190	277	PS50835	Immunoglobulin-like
IPR007110	308	396	PS50835	Immunoglobulin-like
IPR007110	401	488	PS50835	Immunoglobulin-like
IPR007110	493	581	PS50835	Immunoglobulin-like
IPR007110	585	667	PS50835	Immunoglobulin-like
IPR003961	677	769	PS50853	Fibronectin
IPR003961	776	869	PS50853	Fibronectin
IPR003961	874	976	PS50853	Fibronectin
IPR003961	981	1074	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1090 QGWFIGLMCAIALLVLILLIVCF 1112 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1090	QGWFIGLMCAIALLVLILLIVCF	1112	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCACCCCAATACAGAACATC

Primer_r
: TGAGAGCCCTAAGTGAAATTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCACCCCAATACAGAACATC
Primer_r	: TGAGAGCCCTAAGTGAAATTC
PCR product length	: 162 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	6290 bp
Genome contig ID	gi89161185f_203056423
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACACTAAACGTATAATAAAAGTTGTTCAAAATGG
Flanking genome sequence (202151 - 202200)	----+--------+--------+--------+--------+----* ACTCTTGCCATGTGATTTGCTCATTTTCTTGATTTGTTCCTGTTGGTAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	203156423	203258572	26	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0756

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information