HUGE |
Gene/Protein Characteristic Table for KIAA1170 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB032996 |
Description : | Protein FAM40B. |
HUGO Gene Name : | family with sequence similarity 40, member B (FAM40B) |
Clone Name : | hg04224 [Vector Info] |
Flexi ORF Clone : | pF1KA1170
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6645 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 2554 bp Genome contig ID gi89161213f_128761536 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AGCACTTTAATAAAAATAAAATGAGCTGGAATTAGFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 128861536 128979750 25 98.7 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 838 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACTACAGGAGGCTTTATTCAG | |
: TGCTAAATCTCCACATGACAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: ACTACAGGAGGCTTTATTCAG | |
: TGCTAAATCTCCACATGACAC | |
: 175 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |