HUGE |
Gene/Protein Characteristic Table for KIAA1761 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK02052 |
---|---|
Accession No. : | AB051548 |
Description : | Protein FAM40A. |
HUGO Gene Name : | family with sequence similarity 40, member A (FAM40A) |
Clone Name : | ha03234 [Vector Info] |
Flexi ORF Clone : | pF1KA1761
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced fh26843, former representative clones for KIAA1761 with ha03234. (2001/2/07) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3237 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 721 bp Genome contig ID gi89161185f_110278781 PolyA signal sequence
(ATTAAA,-13) +----*----+----*----+----*----+----
TGTGATTGTGTATTCTGTTTACATTAAAAAGAAGCFlanking genome sequence
(119999 - 120048) ----+----*----+----*----+----*----+----*----+----*
AAAAATAATTCCCGTTGGCTTGTCTACAGGAAATATGGCCTCTACGTATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 110378781 110398778 21 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 837 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |