HUGE

Gene/Protein Characteristic Table for KIAA1229

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00774
Accession No. :	AB033055
Description :	outer dense fiber of sperm tails 2-like isoform b.
HUGO Gene Name :	outer dense fiber of sperm tails 2-like (ODF2L)
Clone Name :	fh05775 [Vector Info]
Flexi ORF Clone :	pF1KSDA1229
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5654 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3461 bp

Genome contig ID gi89161185r_86487000
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CAATGTTTGAATAAATTGTCAAATTTATTTTCTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTAGTAGATTTTTATTATGAGTCTAAAATGTGATTGGGTAAAAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 86587000 86634533 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10004	6.9e-200	100.0	outer dense fib...	synthetic construct
Q9ULJ1	1.8e-199	99.8	Outer dense fib...	Homo sapiens
EAW73188	2e-197	99.8	outer dense fib...	Homo sapiens
EAW73191	1.6e-150	96.9	outer dense fib...	Homo sapiens
AAH91490	8.9e-141	91.4	ODF2L protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATCCTGTGGCTTTGTACTG

Primer_r
: AATGACACCTGATACCTTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCATCCTGTGGCTTTGTACTG
Primer_r	: AATGACACCTGATACCTTCTG
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3461 bp
Genome contig ID	gi89161185r_86487000
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAATGTTTGAATAAATTGTCAAATTTATTTTCTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTAGTAGATTTTTATTATGAGTCTAAAATGTGATTGGGTAAAAAAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	86587000	86634533	18	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1229

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information