| HUGE |
Gene/Protein Characteristic Table for KIAA1231 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01156 |
|---|---|
| Accession No. : | AB033057 |
| Description : | PR domain zinc finger protein 10. |
| HUGO Gene Name : | PR domain containing 10 (PRDM10) |
| Clone Name : | fh08195s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA1231
![]() |
| Source : | Human fetal brain |
| Note : | We replaced fh08195, former representative clones for KIAA1231 with fh08195s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5782 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2596 bp Genome contig ID gi51511727r_129174822 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
AAATATATTTTTTAATAAACATGTTTGTATGTGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGCTACAAGAGCTATTTTTTTTTCTTTGAAGAATTGCAACTTTTGGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 129274822 129322511 17 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1061 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GGAAACTGAAAATGGACTCTC | |
| : TCATTACACTGTGGGACTTAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : GeneBridge 4 | |
| : GGAAACTGAAAATGGACTCTC | |
| : TCATTACACTGTGGGACTTAG | |
| : 106 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |