HUGE |
Gene/Protein Characteristic Table for KIAA1241 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05645 |
---|---|
Accession No. : | AB033067 |
Description : | transcription factor-like nuclear regulator. |
HUGO Gene Name : | |
Clone Name : | fh10384 [Vector Info] |
Source : | Human fetal brain |
Note : | Please refer to "Gene/Protein Characteristic Table for KIAA1689" because the cDNA sequence of KIAA1241 is included in KIAA1689. |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5755 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 863 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTCAGATTTGCCTTCATTCG | |
: GGAAGCGACCTCTCAACATTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: CTTCAGATTTGCCTTCATTCG | |
: GGAAGCGACCTCTCAACATTG | |
: 159(2k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |