HUGE

Gene/Protein Characteristic Table for KIAA1689

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01694
Accession No. :	AB051476
Description :	transcription factor-like nuclear regulator.
HUGO Gene Name :	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB (BDP1)
Clone Name :	bg00184s4 [Vector Info]
Flexi ORF Clone :	pF1KA1689
Source :	Human adult brain
Note :	We replaced fh26762 and bg00184, former representative clones for KIAA1689 with bg00184s4. (2002/5/10,2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10819 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2934 bp

Genome contig ID gi51511721f_70687451
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TATATAAATTATGTAAATAAAAGTTATTTTATATC
Flanking genome sequence
(211953 - 212002)
----+----*----+----*----+----*----+----*----+----*
ATTTCTGTTGTGTCCTTTTAAGATGACTAAATAAAGAATTGGCTGGGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 70787451 70899402 39 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46793	100.0	B double prime ...	Homo sapiens
A6H8Y1	99.9	Transcription f...	Homo sapiens
AAI61615	100.0	BDP1 protein [H...	Homo sapiens
EAW95689	99.8	B double prime ...	Homo sapiens
NP_060899	99.8	transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033067	5.2e-168	96.8	KIAA1241
AB020652	0.00033	20.6	KIAA0845

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014778 303 348 PF00249 Myb

HMMSmart IPR001005 302 350 SM00717 SANT

ScanRegExp IPR000977 347 355 PS00697 ATP-dependent DNA ligase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	303	348	PF00249	Myb
HMMSmart	IPR001005	302	350	SM00717	SANT
ScanRegExp	IPR000977	347	355	PS00697	ATP-dependent DNA ligase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGCTTGGGAGTTAGATTGCC

Primer_r
: AGGATACTTTAGCTGGCTGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2934 bp
Genome contig ID	gi51511721f_70687451
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATATAAATTATGTAAATAAAAGTTATTTTATATC
Flanking genome sequence (211953 - 212002)	----+--------+--------+--------+--------+----* ATTTCTGTTGTGTCCTTTTAAGATGACTAAATAAAGAATTGGCTGGGTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	70787451	70899402	39	99.8	Perfect prediction

Primer_f	: TAGCTTGGGAGTTAGATTGCC
Primer_r	: AGGATACTTTAGCTGGCTGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1689

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information