HUGE

Gene/Protein Characteristic Table for KIAA1242

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00776
Accession No. :	AB033068
Description :	Fizzy-related protein homolog.
HUGO Gene Name :	fizzy/cell division cycle 20 related 1 (Drosophila) (FZR1)
Clone Name :	fh10406 [Vector Info]
Flexi ORF Clone :	pF1KSDA1242
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5008 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3492 bp

Genome contig ID gi42406306f_3373954
PolyA signal sequence
(AATACA,-20)
+----*----+----*----+----*----+----
TGTTTATTGTGGTAAAATACAAAATCTACCGTCTT
Flanking genome sequence
(115373 - 115422)
----+----*----+----*----+----*----+----*----+----*
ACAGTGAGGTGGCGTTCAGTACCTTCACCACGCCGTGCAGCCATCCCATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 3473954 3489325 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 504 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001117911	6e-206	99.8	similar to Fzr1...	Macaca mulatta
AAD52030	1.3e-201	100.0	fizzy-related p...	Homo sapiens
AAP36844	1.3e-201	100.0	Fzr1 protein [s...	synthetic construct
Q9UM11	1.4e-200	99.4	Fizzy-related p...	Homo sapiens
BAA86954	3.3e-200	99.2	Fzr1 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075822	3.4e-06	26.2	KIAA1942
AB020700	1.8e-05	24.1	KIAA0893
AB051495	7e-05	25.5	KIAA1708
AB014596	0.00026	23.1	KIAA0696

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000002 171 229 PD004563 Cdc20/Fizzy

IPR001680 320 351 PD000018 WD40 repeat

IPR001680 450 483 PD000018 WD40 repeat

FPrintScan IPR001680 339 353 PR00320 WD40 repeat

IPR001680 384 398 PR00320 WD40 repeat

IPR001680 469 483 PR00320 WD40 repeat

HMMPfam IPR001680 230 268 PF00400 WD40 repeat

IPR001680 272 308 PF00400 WD40 repeat

IPR001680 314 352 PF00400 WD40 repeat

IPR001680 356 386 PF00400 WD40 repeat

IPR001680 444 482 PF00400 WD40 repeat

HMMSmart IPR001680 229 268 SM00320 WD40 repeat

IPR001680 271 308 SM00320 WD40 repeat

IPR001680 313 352 SM00320 WD40 repeat

IPR001680 355 397 SM00320 WD40 repeat

IPR001680 400 440 SM00320 WD40 repeat

IPR001680 443 482 SM00320 WD40 repeat

ProfileScan IPR001680 236 277 PS50082 WD40 repeat

IPR001680 236 491 PS50294 WD40 repeat

IPR001680 320 361 PS50082 WD40 repeat

IPR001680 450 491 PS50082 WD40 repeat

ScanRegExp IPR001680 384 398 PS00678 WD40 repeat

IPR001680 469 483 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000002	171	229	PD004563	Cdc20/Fizzy
IPR001680	320	351	PD000018	WD40 repeat
IPR001680	450	483	PD000018	WD40 repeat
FPrintScan	IPR001680	339	353	PR00320	WD40 repeat
IPR001680	384	398	PR00320	WD40 repeat
IPR001680	469	483	PR00320	WD40 repeat
HMMPfam	IPR001680	230	268	PF00400	WD40 repeat
IPR001680	272	308	PF00400	WD40 repeat
IPR001680	314	352	PF00400	WD40 repeat
IPR001680	356	386	PF00400	WD40 repeat
IPR001680	444	482	PF00400	WD40 repeat
HMMSmart	IPR001680	229	268	SM00320	WD40 repeat
IPR001680	271	308	SM00320	WD40 repeat
IPR001680	313	352	SM00320	WD40 repeat
IPR001680	355	397	SM00320	WD40 repeat
IPR001680	400	440	SM00320	WD40 repeat
IPR001680	443	482	SM00320	WD40 repeat
ProfileScan	IPR001680	236	277	PS50082	WD40 repeat
IPR001680	236	491	PS50294	WD40 repeat
IPR001680	320	361	PS50082	WD40 repeat
IPR001680	450	491	PS50082	WD40 repeat
ScanRegExp	IPR001680	384	398	PS00678	WD40 repeat
IPR001680	469	483	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 206 WSSLNVLSVGLGTCVYLWSACTS 228 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	206	WSSLNVLSVGLGTCVYLWSACTS	228	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAGTGTACGTCAGGCTTTGC

Primer_r
: GCTACATTCCAGGATCAACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGAGTGTACGTCAGGCTTTGC
Primer_r	: GCTACATTCCAGGATCAACAG
PCR product length	: 220 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3492 bp
Genome contig ID	gi42406306f_3373954
PolyA signal sequence (AATACA,-20)	+--------+--------+----*----+---- TGTTTATTGTGGTAAAATACAAAATCTACCGTCTT
Flanking genome sequence (115373 - 115422)	----+--------+--------+--------+--------+----* ACAGTGAGGTGGCGTTCAGTACCTTCACCACGCCGTGCAGCCATCCCATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	3473954	3489325	13	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1242

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information