HUGE

Gene/Protein Characteristic Table for KIAA0696

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00609
Accession No. :	AB014596
Description :	F-box/WD repeat protein 11.
HUGO Gene Name :	F-box and WD repeat domain containing 11 (FBXW11)
Clone Name :	hk04053 [Vector Info]
Flexi ORF Clone :	pF1KSDA0696
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4230 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2576 bp

Genome contig ID gi51511721r_171121161
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAAGCCAATACTCTTAATAAAGTGTTGCAATACTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGACGTTCTGTTAAGAAATTTTTCAAAGAAACTGTTAAGTGCTGTTAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 171221161 171366136 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UKB1	0	100.0	F-box/WD repeat...	Homo sapiens
CAI25520	0	99.6	F-box and WD-40...	Mus musculus
BAG58031	4e-215	100.0	unnamed protein...	Homo sapiens
BAA92330	4.1e-215	94.3	F-box and WD-re...	Homo sapiens
XP_001499717	4.1e-215	94.3	F-box and WD re...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007873	8.5e-08	26.8	KIAA0413
AB040882	1.9e-05	27.9	KIAA1449
AB033068	3e-05	22.6	KIAA1242
AB007918	4.4e-05	25.9	KIAA0449
AB011168	8.1e-05	24.6	KIAA0596

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 247 274 PD000018 WD40 repeat

IPR001680 283 315 PD000018 WD40 repeat

IPR001680 366 398 PD000018 WD40 repeat

IPR001680 406 438 PD000018 WD40 repeat

IPR001680 446 478 PD000018 WD40 repeat

FPrintScan IPR001680 301 315 PR00320 WD40 repeat

IPR001680 424 438 PR00320 WD40 repeat

IPR001680 464 478 PR00320 WD40 repeat

HMMPfam IPR001810 126 177 PF00646 Cyclin-like F-box

IPR001680 238 274 PF00400 WD40 repeat

IPR001680 278 314 PF00400 WD40 repeat

IPR001680 318 354 PF00400 WD40 repeat

IPR001680 361 397 PF00400 WD40 repeat

IPR001680 401 437 PF00400 WD40 repeat

IPR001680 441 477 PF00400 WD40 repeat

IPR001680 490 526 PF00400 WD40 repeat

HMMSmart IPR001810 136 175 SM00256 Cyclin-like F-box

IPR001680 237 274 SM00320 WD40 repeat

IPR001680 277 314 SM00320 WD40 repeat

IPR001680 317 354 SM00320 WD40 repeat

IPR001680 360 397 SM00320 WD40 repeat

IPR001680 400 437 SM00320 WD40 repeat

IPR001680 440 477 SM00320 WD40 repeat

IPR001680 489 526 SM00320 WD40 repeat

ProfileScan IPR001810 137 175 PS50181 Cyclin-like F-box

IPR001680 244 283 PS50082 WD40 repeat

IPR001680 244 535 PS50294 WD40 repeat

IPR001680 284 323 PS50082 WD40 repeat

IPR001680 324 363 PS50082 WD40 repeat

IPR001680 367 406 PS50082 WD40 repeat

IPR001680 407 446 PS50082 WD40 repeat

IPR001680 447 479 PS50082 WD40 repeat

IPR001680 496 526 PS50082 WD40 repeat

ScanRegExp IPR001680 301 315 PS00678 WD40 repeat

IPR001680 341 355 PS00678 WD40 repeat

IPR001680 424 438 PS00678 WD40 repeat

IPR001680 464 478 PS00678 WD40 repeat

IPR001680 513 527 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	247	274	PD000018	WD40 repeat
IPR001680	283	315	PD000018	WD40 repeat
IPR001680	366	398	PD000018	WD40 repeat
IPR001680	406	438	PD000018	WD40 repeat
IPR001680	446	478	PD000018	WD40 repeat
FPrintScan	IPR001680	301	315	PR00320	WD40 repeat
IPR001680	424	438	PR00320	WD40 repeat
IPR001680	464	478	PR00320	WD40 repeat
HMMPfam	IPR001810	126	177	PF00646	Cyclin-like F-box
IPR001680	238	274	PF00400	WD40 repeat
IPR001680	278	314	PF00400	WD40 repeat
IPR001680	318	354	PF00400	WD40 repeat
IPR001680	361	397	PF00400	WD40 repeat
IPR001680	401	437	PF00400	WD40 repeat
IPR001680	441	477	PF00400	WD40 repeat
IPR001680	490	526	PF00400	WD40 repeat
HMMSmart	IPR001810	136	175	SM00256	Cyclin-like F-box
IPR001680	237	274	SM00320	WD40 repeat
IPR001680	277	314	SM00320	WD40 repeat
IPR001680	317	354	SM00320	WD40 repeat
IPR001680	360	397	SM00320	WD40 repeat
IPR001680	400	437	SM00320	WD40 repeat
IPR001680	440	477	SM00320	WD40 repeat
IPR001680	489	526	SM00320	WD40 repeat
ProfileScan	IPR001810	137	175	PS50181	Cyclin-like F-box
IPR001680	244	283	PS50082	WD40 repeat
IPR001680	244	535	PS50294	WD40 repeat
IPR001680	284	323	PS50082	WD40 repeat
IPR001680	324	363	PS50082	WD40 repeat
IPR001680	367	406	PS50082	WD40 repeat
IPR001680	407	446	PS50082	WD40 repeat
IPR001680	447	479	PS50082	WD40 repeat
IPR001680	496	526	PS50082	WD40 repeat
ScanRegExp	IPR001680	301	315	PS00678	WD40 repeat
IPR001680	341	355	PS00678	WD40 repeat
IPR001680	424	438	PS00678	WD40 repeat
IPR001680	464	478	PS00678	WD40 repeat
IPR001680	513	527	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCTTTGTACTGTGGAATGTG

Primer_r
: ATTGCATGAAGCCAGATTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCTTTGTACTGTGGAATGTG
Primer_r	: ATTGCATGAAGCCAGATTAGG
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2576 bp
Genome contig ID	gi51511721r_171121161
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAAGCCAATACTCTTAATAAAGTGTTGCAATACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGACGTTCTGTTAAGAAATTTTTCAAAGAAACTGTTAAGTGCTGTTAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	171221161	171366136	13	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0696

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information