HUGE

Gene/Protein Characteristic Table for KIAA0413

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04119
Accession No. :	AB007873
Description :	Apoptotic protease-activating factor 1.
HUGO Gene Name :
Clone Name :	hh00077s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh00077, former representative clones for KIAA0413 with hh00077s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6574 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2860 bp

Genome contig ID gi89161190f_97466269
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
ATTTTTGTAAAAATAAAATTCACAAAATTGTTTTG
Flanking genome sequence
(187068 - 187117)
----+----*----+----*----+----*----+----*----+----*
AAAAACATTTTTGGATTGTTTCATTCTTTGCTTGTCATTTATCTGTTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 97566269 97653335 26 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD38344	99.9	apoptotic prote...	Homo sapiens
EAW97610	99.7	apoptotic pepti...	Homo sapiens
XP_001151785	99.4	apoptotic prote...	Pan troglodytes
XP_001086945	97.2	apoptotic pepti...	Macaca mulatta
O14727	99.0	Apoptotic prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014596	1.3e-07	26.2	KIAA0696
AB040882	3.6e-07	25.3	KIAA1449
AB011168	9e-07	19.5	KIAA0596
D26488	0.00092	26.1	KIAA0007

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 643 674 PD000018 WD40 repeat

IPR001680 727 760 PD000018 WD40 repeat

IPR001680 867 898 PD000018 WD40 repeat

IPR001680 991 1020 PD000018 WD40 repeat

FPrintScan IPR000767 138 153 PR00364 Disease resistance protein

IPR000767 221 235 PR00364 Disease resistance protein

IPR000767 306 320 PR00364 Disease resistance protein

IPR001680 705 719 PR00320 WD40 repeat

IPR001680 747 761 PR00320 WD40 repeat

IPR001680 1047 1061 PR00320 WD40 repeat

HMMPfam IPR001315 6 90 PF00619 Caspase Recruitment

IPR002182 98 403 PF00931 NB-ARC

IPR001680 594 632 PF00400 WD40 repeat

IPR001680 636 674 PF00400 WD40 repeat

IPR001680 678 718 PF00400 WD40 repeat

IPR001680 722 760 PF00400 WD40 repeat

IPR001680 861 899 PF00400 WD40 repeat

IPR001680 982 1020 PF00400 WD40 repeat

IPR001680 1023 1060 PF00400 WD40 repeat

IPR001680 1064 1102 PF00400 WD40 repeat

IPR001680 1106 1144 PF00400 WD40 repeat

IPR001680 1165 1192 PF00400 WD40 repeat

HMMSmart IPR001680 593 632 SM00320 WD40 repeat

IPR001680 635 674 SM00320 WD40 repeat

IPR001680 677 718 SM00320 WD40 repeat

IPR001680 721 760 SM00320 WD40 repeat

IPR001680 776 814 SM00320 WD40 repeat

IPR001680 817 857 SM00320 WD40 repeat

IPR001680 860 899 SM00320 WD40 repeat

IPR001680 941 978 SM00320 WD40 repeat

IPR001680 982 1020 SM00320 WD40 repeat

IPR001680 1022 1060 SM00320 WD40 repeat

IPR001680 1063 1102 SM00320 WD40 repeat

IPR001680 1105 1144 SM00320 WD40 repeat

IPR001680 1156 1192 SM00320 WD40 repeat

ProfileScan IPR001315 1 90 PS50209 Caspase Recruitment

IPR001680 600 641 PS50082 WD40 repeat

IPR001680 600 1237 PS50294 WD40 repeat

IPR001680 642 683 PS50082 WD40 repeat

IPR001680 684 727 PS50082 WD40 repeat

IPR001680 728 769 PS50082 WD40 repeat

IPR001680 867 899 PS50082 WD40 repeat

IPR001680 988 1020 PS50082 WD40 repeat

IPR001680 1029 1069 PS50082 WD40 repeat

IPR001680 1070 1104 PS50082 WD40 repeat

IPR001680 1112 1153 PS50082 WD40 repeat

ScanRegExp IPR001680 661 675 PS00678 WD40 repeat

IPR001680 705 719 PS00678 WD40 repeat

IPR001680 747 761 PS00678 WD40 repeat

IPR001680 1131 1145 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	643	674	PD000018	WD40 repeat
IPR001680	727	760	PD000018	WD40 repeat
IPR001680	867	898	PD000018	WD40 repeat
IPR001680	991	1020	PD000018	WD40 repeat
FPrintScan	IPR000767	138	153	PR00364	Disease resistance protein
IPR000767	221	235	PR00364	Disease resistance protein
IPR000767	306	320	PR00364	Disease resistance protein
IPR001680	705	719	PR00320	WD40 repeat
IPR001680	747	761	PR00320	WD40 repeat
IPR001680	1047	1061	PR00320	WD40 repeat
HMMPfam	IPR001315	6	90	PF00619	Caspase Recruitment
IPR002182	98	403	PF00931	NB-ARC
IPR001680	594	632	PF00400	WD40 repeat
IPR001680	636	674	PF00400	WD40 repeat
IPR001680	678	718	PF00400	WD40 repeat
IPR001680	722	760	PF00400	WD40 repeat
IPR001680	861	899	PF00400	WD40 repeat
IPR001680	982	1020	PF00400	WD40 repeat
IPR001680	1023	1060	PF00400	WD40 repeat
IPR001680	1064	1102	PF00400	WD40 repeat
IPR001680	1106	1144	PF00400	WD40 repeat
IPR001680	1165	1192	PF00400	WD40 repeat
HMMSmart	IPR001680	593	632	SM00320	WD40 repeat
IPR001680	635	674	SM00320	WD40 repeat
IPR001680	677	718	SM00320	WD40 repeat
IPR001680	721	760	SM00320	WD40 repeat
IPR001680	776	814	SM00320	WD40 repeat
IPR001680	817	857	SM00320	WD40 repeat
IPR001680	860	899	SM00320	WD40 repeat
IPR001680	941	978	SM00320	WD40 repeat
IPR001680	982	1020	SM00320	WD40 repeat
IPR001680	1022	1060	SM00320	WD40 repeat
IPR001680	1063	1102	SM00320	WD40 repeat
IPR001680	1105	1144	SM00320	WD40 repeat
IPR001680	1156	1192	SM00320	WD40 repeat
ProfileScan	IPR001315	1	90	PS50209	Caspase Recruitment
IPR001680	600	641	PS50082	WD40 repeat
IPR001680	600	1237	PS50294	WD40 repeat
IPR001680	642	683	PS50082	WD40 repeat
IPR001680	684	727	PS50082	WD40 repeat
IPR001680	728	769	PS50082	WD40 repeat
IPR001680	867	899	PS50082	WD40 repeat
IPR001680	988	1020	PS50082	WD40 repeat
IPR001680	1029	1069	PS50082	WD40 repeat
IPR001680	1070	1104	PS50082	WD40 repeat
IPR001680	1112	1153	PS50082	WD40 repeat
ScanRegExp	IPR001680	661	675	PS00678	WD40 repeat
IPR001680	705	719	PS00678	WD40 repeat
IPR001680	747	761	PS00678	WD40 repeat
IPR001680	1131	1145	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTCATCTGCAAACTACAAAAC

Primer_r
: CATGAAGAAAGAAGAGATACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTCATCTGCAAACTACAAAAC
Primer_r	: CATGAAGAAAGAAGAGATACC
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2860 bp
Genome contig ID	gi89161190f_97466269
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATTTTTGTAAAAATAAAATTCACAAAATTGTTTTG
Flanking genome sequence (187068 - 187117)	----+--------+--------+--------+--------+----* AAAAACATTTTTGGATTGTTTCATTCTTTGCTTGTCATTTATCTGTTGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	97566269	97653335	26	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0413

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information