HUGE

Gene/Protein Characteristic Table for KIAA1449

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01167
Accession No. :	AB040882
Description :	WD repeat protein 48.
HUGO Gene Name :	WD repeat domain 48 (WDR48)
Clone Name :	fk04105 [Vector Info]
Flexi ORF Clone :	pF1KA1449
Source :	Human fetal brain
Note :	We replaced fh12395, former representative clones for KIAA1449 with fk04105. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3970 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1925 bp

Genome contig ID gi89161205f_38968510
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
GTTGTATAGAATAAAGGCTTTAGTTAAAATATTTC
Flanking genome sequence
(144655 - 144704)
----+----*----+----*----+----*----+----*----+----*
AAAGTGTAGTACACATTTATTTTCATTTGTTATTTTCTTTCATAGCAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 39068510 39113163 19 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 680 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516374	100.0	WD repeat domai...	Pan troglodytes
XP_001083670	100.0	similar to WD r...	Macaca mulatta
Q8TAF3	100.0	WD repeat-conta...	Homo sapiens
XP_001498347	99.9	WD repeat domai...	Equus caballus
Q5RAW8	99.9	WD repeat-conta...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007873	1.6e-07	25.3	KIAA0413
AB020700	2e-06	23.1	KIAA0893
AB014596	1.3e-05	27.9	KIAA0696
AB051495	6.6e-05	22.0	KIAA1708
AB037856	6.6e-05	22.8	KIAA1435

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 209 242 PD000018 WD40 repeat

FPrintScan IPR001680 93 107 PR00320 WD40 repeat

IPR001680 186 200 PR00320 WD40 repeat

IPR001680 228 242 PR00320 WD40 repeat

HMMPfam IPR001680 34 61 PF00400 WD40 repeat

IPR001680 68 106 PF00400 WD40 repeat

IPR001680 110 148 PF00400 WD40 repeat

IPR001680 161 199 PF00400 WD40 repeat

IPR001680 203 241 PF00400 WD40 repeat

IPR001680 245 283 PF00400 WD40 repeat

HMMSmart IPR001680 17 61 SM00320 WD40 repeat

IPR001680 67 106 SM00320 WD40 repeat

IPR001680 109 148 SM00320 WD40 repeat

IPR001680 160 199 SM00320 WD40 repeat

IPR001680 202 241 SM00320 WD40 repeat

IPR001680 244 283 SM00320 WD40 repeat

IPR001680 353 391 SM00320 WD40 repeat

ProfileScan IPR001680 29 63 PS50082 WD40 repeat

IPR001680 29 292 PS50294 WD40 repeat

IPR001680 74 115 PS50082 WD40 repeat

IPR001680 116 157 PS50082 WD40 repeat

IPR001680 167 208 PS50082 WD40 repeat

IPR001680 209 250 PS50082 WD40 repeat

ScanRegExp IPR001680 93 107 PS00678 WD40 repeat

IPR001680 135 149 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	209	242	PD000018	WD40 repeat
FPrintScan	IPR001680	93	107	PR00320	WD40 repeat
IPR001680	186	200	PR00320	WD40 repeat
IPR001680	228	242	PR00320	WD40 repeat
HMMPfam	IPR001680	34	61	PF00400	WD40 repeat
IPR001680	68	106	PF00400	WD40 repeat
IPR001680	110	148	PF00400	WD40 repeat
IPR001680	161	199	PF00400	WD40 repeat
IPR001680	203	241	PF00400	WD40 repeat
IPR001680	245	283	PF00400	WD40 repeat
HMMSmart	IPR001680	17	61	SM00320	WD40 repeat
IPR001680	67	106	SM00320	WD40 repeat
IPR001680	109	148	SM00320	WD40 repeat
IPR001680	160	199	SM00320	WD40 repeat
IPR001680	202	241	SM00320	WD40 repeat
IPR001680	244	283	SM00320	WD40 repeat
IPR001680	353	391	SM00320	WD40 repeat
ProfileScan	IPR001680	29	63	PS50082	WD40 repeat
IPR001680	29	292	PS50294	WD40 repeat
IPR001680	74	115	PS50082	WD40 repeat
IPR001680	116	157	PS50082	WD40 repeat
IPR001680	167	208	PS50082	WD40 repeat
IPR001680	209	250	PS50082	WD40 repeat
ScanRegExp	IPR001680	93	107	PS00678	WD40 repeat
IPR001680	135	149	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAACACTGTCACAACTTCTTC

Primer_r
: TCTCTGTTTAATAGCAATGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1925 bp
Genome contig ID	gi89161205f_38968510
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GTTGTATAGAATAAAGGCTTTAGTTAAAATATTTC
Flanking genome sequence (144655 - 144704)	----+--------+--------+--------+--------+----* AAAGTGTAGTACACATTTATTTTCATTTGTTATTTTCTTTCATAGCAGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	39068510	39113163	19	100.0	Perfect prediction

Primer_f	: TAACACTGTCACAACTTCTTC
Primer_r	: TCTCTGTTTAATAGCAATGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1449

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information