| HUGE |
Gene/Protein Characteristic Table for KIAA1435 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00833 |
|---|---|
| Accession No. : | AB037856 |
| Description : | WD repeat and FYVE domain-containing protein 1. |
| HUGO Gene Name : | WD repeat and FYVE domain containing 1 (WDFY1) |
| Clone Name : | hh13841 [Vector Info] |
| Flexi ORF Clone : | pF1KA1435
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4574 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3325 bp Genome contig ID gi89161199r_224348357 PolyA signal sequence
(AATAAA,-22)
AGAAAATGTACACAATAAAACATTCCTTGCTTGTTFlanking genome sequence
(99953 - 99904)
ACTGTGTTTGCCTAATATCACTTTTGTTGTAGTCAGCCTGGACGTAGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 224448310 224518261 12 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 415 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AAAGAAGTTAGTGACCCAGAG | |
| : ACAGGCTCCTCATTTCTTCTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
