HUGE |
Gene/Protein Characteristic Table for KIAA1708 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00269 |
---|---|
Accession No. : | AB051495 |
Description : | Kinesin-like protein KIF21A. |
HUGO Gene Name : | |
Clone Name : | fj17878y1 [Vector Info] |
Flexi ORF Clone : | pF1KA1708
![]() |
Source : | Human fetal brain |
Note : | We replaced fj17878, former representative clones for KIAA1708 with fj17878y1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6170 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1195 bp Genome contig ID gi89161190r_37873298 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AGCTAGGGCTTAAATAAACATGTTGCTATGAAATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTTTACTGTATTGTTCTTTTTCCAAATTGCAAGAGAATGGCCAGTGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 37973298 38123028 36 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1657 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 12 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |