HUGE

Gene/Protein Characteristic Table for KIAA0449

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05752
Accession No. :	AB007918
Description :	Kinesin-like protein KIF21B.
HUGO Gene Name :	kinesin family member 21B (KIF21B)
Clone Name :	ff06247 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hg00177, former representative clones for KIAA0449 with ff06247. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 9895 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4703 bp

Genome contig ID gi89161185r_199105143
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TCTAAGAAGTTGTCATAAATAAAACCTGAATGACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTCTGTGGAGGTGTCCCCTGTCCCCTTCCAGGGGGCTGCTGACTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 199205143 199259451 34 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1628 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_060066	100.0	kinesin family ...	Homo sapiens
AAI44558	99.8	KIF21B protein ...	Homo sapiens
XP_001916157	96.2	kinesin family ...	Equus caballus
EAW91329	99.2	hCG2027369, iso...	Homo sapiens
EAW91328	98.9	hCG2027369, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051495	8.7e-106	60.1	KIAA1708
AB002357	2.2e-08	29.4	KIAA0359
AB037826	5.2e-08	33.4	KIAA1405
AB011103	1.5e-07	27.3	KIAA0531
AB014539	1.8e-07	29.6	KIAA0639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 82 103 PR00380 Kinesin

IPR001752 220 237 PR00380 Kinesin

IPR001752 324 345 PR00380 Kinesin

IPR001680 1312 1326 PR00320 WD40 repeat

IPR001680 1508 1522 PR00320 WD40 repeat

IPR001680 1591 1605 PR00320 WD40 repeat

HMMPfam IPR001752 18 375 PF00225 Kinesin

IPR001680 1289 1325 PF00400 WD40 repeat

IPR001680 1329 1366 PF00400 WD40 repeat

IPR001680 1393 1430 PF00400 WD40 repeat

IPR001680 1434 1475 PF00400 WD40 repeat

IPR001680 1485 1521 PF00400 WD40 repeat

IPR001680 1526 1564 PF00400 WD40 repeat

IPR001680 1568 1604 PF00400 WD40 repeat

HMMSmart IPR001752 10 382 SM00129 Kinesin

IPR001680 1288 1325 SM00320 WD40 repeat

IPR001680 1328 1366 SM00320 WD40 repeat

IPR001680 1393 1430 SM00320 WD40 repeat

IPR001680 1433 1475 SM00320 WD40 repeat

IPR001680 1483 1521 SM00320 WD40 repeat

IPR001680 1524 1564 SM00320 WD40 repeat

IPR001680 1567 1604 SM00320 WD40 repeat

ProfileScan IPR001752 9 302 PS50067 Kinesin

IPR001680 1295 1334 PS50082 WD40 repeat

IPR001680 1295 1613 PS50294 WD40 repeat

IPR001680 1491 1530 PS50082 WD40 repeat

IPR001680 1532 1573 PS50082 WD40 repeat

IPR001680 1574 1604 PS50082 WD40 repeat

ScanRegExp IPR001752 271 282 PS00411 Kinesin

IPR001680 1312 1326 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	82	103	PR00380	Kinesin
IPR001752	220	237	PR00380	Kinesin
IPR001752	324	345	PR00380	Kinesin
IPR001680	1312	1326	PR00320	WD40 repeat
IPR001680	1508	1522	PR00320	WD40 repeat
IPR001680	1591	1605	PR00320	WD40 repeat
HMMPfam	IPR001752	18	375	PF00225	Kinesin
IPR001680	1289	1325	PF00400	WD40 repeat
IPR001680	1329	1366	PF00400	WD40 repeat
IPR001680	1393	1430	PF00400	WD40 repeat
IPR001680	1434	1475	PF00400	WD40 repeat
IPR001680	1485	1521	PF00400	WD40 repeat
IPR001680	1526	1564	PF00400	WD40 repeat
IPR001680	1568	1604	PF00400	WD40 repeat
HMMSmart	IPR001752	10	382	SM00129	Kinesin
IPR001680	1288	1325	SM00320	WD40 repeat
IPR001680	1328	1366	SM00320	WD40 repeat
IPR001680	1393	1430	SM00320	WD40 repeat
IPR001680	1433	1475	SM00320	WD40 repeat
IPR001680	1483	1521	SM00320	WD40 repeat
IPR001680	1524	1564	SM00320	WD40 repeat
IPR001680	1567	1604	SM00320	WD40 repeat
ProfileScan	IPR001752	9	302	PS50067	Kinesin
IPR001680	1295	1334	PS50082	WD40 repeat
IPR001680	1295	1613	PS50294	WD40 repeat
IPR001680	1491	1530	PS50082	WD40 repeat
IPR001680	1532	1573	PS50082	WD40 repeat
IPR001680	1574	1604	PS50082	WD40 repeat
ScanRegExp	IPR001752	271	282	PS00411	Kinesin
IPR001680	1312	1326	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACACACACATCCAATCTAGG
Primer_r	: CCTGCTGTCCTCCATGATGTG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4703 bp
Genome contig ID	gi89161185r_199105143
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCTAAGAAGTTGTCATAAATAAAACCTGAATGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTCTGTGGAGGTGTCCCCTGTCCCCTTCCAGGGGGCTGCTGACTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	199205143	199259451	34	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0449

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information