HUGE |
Gene/Protein Characteristic Table for KIAA0359 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00515 |
---|---|
Accession No. : | AB002357 |
Description : | Kinesin-like protein KIF3B. |
HUGO Gene Name : | kinesin family member 3B (KIF3B) |
Clone Name : | hh00048 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0359 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4724 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2313 bp Genome contig ID gi51511747f_30261175 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATTCCAGCCTGGGTGACAGAGTGAGACTCCACCTCFlanking genome sequence
(123923 - 123972) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAACAGAAAGAAAGAAAAAGAAAACTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 30329128 30385096 9 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 760 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TGAGGAAATGTGGTGTGAGAG | |
: AGAACAAAACGCTAAGGTGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: TGAGGAAATGTGGTGTGAGAG | |
: AGAACAAAACGCTAAGGTGGG | |
: 76 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |