HUGE

Gene/Protein Characteristic Table for KIAA1405

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05750
Accession No. :	AB037826
Description :	Kinesin-like protein KIF17.
HUGO Gene Name :	kinesin family member 17 (KIF17)
Clone Name :	fg03134s1 [Vector Info]
Flexi ORF Clone :	pF1KA1405
Source :	Human fetal brain
Note :	We replaced fg03134, former representative clones for KIAA1405 with fg03134s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 3570 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 568 bp

Genome contig ID gi89161185r_20763096
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCACATTAAGCTGCCCAATAAACTGCTTTTAAGAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCTCCCCTTCTCTGACCCTCTGACAGTGTCACTTGGGGCCCCTCCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 20863096 20916571 15 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 993 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAR33039	99.9	kinesin isoform...	Homo sapiens
Q9P2E2	99.8	Kinesin-like pr...	Homo sapiens
CAM12850	99.6	kinesin family ...	Homo sapiens
AAH65927	99.7	Kinesin family ...	Homo sapiens
EAW94944	99.8	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002357	2.6e-46	40.0	KIAA0359
AB014606	1.2e-30	29.4	KIAA0706
AB014539	6.3e-30	47.3	KIAA0639
AB040881	8.8e-30	29.9	KIAA1448
AB011103	2.8e-27	28.8	KIAA0531

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 46 67 PR00380 Kinesin

IPR001752 165 182 PR00380 Kinesin

IPR001752 199 217 PR00380 Kinesin

IPR001752 249 270 PR00380 Kinesin

HMMPfam IPR001752 6 300 PF00225 Kinesin

HMMSmart IPR001752 6 307 SM00129 Kinesin

ProfileScan IPR001752 41 229 PS50067 Kinesin

ScanRegExp IPR001752 198 209 PS00411 Kinesin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	46	67	PR00380	Kinesin
IPR001752	165	182	PR00380	Kinesin
IPR001752	199	217	PR00380	Kinesin
IPR001752	249	270	PR00380	Kinesin
HMMPfam	IPR001752	6	300	PF00225	Kinesin
HMMSmart	IPR001752	6	307	SM00129	Kinesin
ProfileScan	IPR001752	41	229	PS50067	Kinesin
ScanRegExp	IPR001752	198	209	PS00411	Kinesin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAAGATTCTGCGTGAGTCCTG

Primer_r
: TTTTCACTGTTGCTCCGACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	568 bp
Genome contig ID	gi89161185r_20763096
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCACATTAAGCTGCCCAATAAACTGCTTTTAAGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTCCCCTTCTCTGACCCTCTGACAGTGTCACTTGGGGCCCCTCCCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	20863096	20916571	15	99.6	Perfect prediction

Primer_f	: GAAGATTCTGCGTGAGTCCTG
Primer_r	: TTTTCACTGTTGCTCCGACTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1405

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information