HUGE

Gene/Protein Characteristic Table for KIAA1245

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00778
Accession No. :	AB033071
Description :
HUGO Gene Name :
Clone Name :	hg04073 [Vector Info]
Flexi ORF Clone :	pF1KSDA1245
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161185f_143213012
PolyA signal sequence
(AAGAAA,-23)
+----*----+----*----+----*----+----
AAGGGGAAGGGGAAGAAAAGAAGGGGAAGAAGATC
Flanking genome sequence
(862958 - 863007)
----+----*----+----*----+----*----+----*----+----*
AAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGATCAAAACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 143309862 144075968 54 96.8 Terminal No-hit

ContigView(URL based/DAS) 1 r 146042726 146082596 26 98.7 Both No-hit

ContigView(URL based/DAS) 1 f 146827464 147023143 27 96.6 Both No-hit

Features of the protein sequence	Description

Length: 892 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10008	0	100.0	neuroblastoma b...	synthetic construct
Q3BBV0	0	95.2	Neuroblastoma b...	Homo sapiens
Q86T75	2.8e-189	97.3	Neuroblastoma b...	Homo sapiens
A6NDD8	5.8e-189	97.2	Neuroblastoma b...	Homo sapiens
BAH13700	5.6e-181	97.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051480	2.3e-100	94.1	KIAA1693
AB007923	0.00037	22.7	KIAA0454

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010630 200 266 PF06758 Protein of unknown function DUF1220

IPR010630 471 537 PF06758 Protein of unknown function DUF1220

IPR010630 745 807 PF06758 Protein of unknown function DUF1220

IPR010630 831 892 PF06758 Protein of unknown function DUF1220

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010630	200	266	PF06758	Protein of unknown function DUF1220
IPR010630	471	537	PF06758	Protein of unknown function DUF1220
IPR010630	745	807	PF06758	Protein of unknown function DUF1220
IPR010630	831	892	PF06758	Protein of unknown function DUF1220

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCATTGTCTTCTTCAGGTGGC

Primer_r
: GTAACCGTCTTGATCCATAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCATCACTTGTTCAAATAGCC
Primer_r	: GAGAGGATGAGCCAATGAGAG
PCR product length	: 114 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	0 bp
Genome contig ID	gi89161185f_143213012
PolyA signal sequence (AAGAAA,-23)	+--------+--------+----*----+---- AAGGGGAAGGGGAAGAAAAGAAGGGGAAGAAGATC
Flanking genome sequence (862958 - 863007)	----+--------+--------+--------+--------+----* AAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGATCAAAACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	143309862	144075968	54	96.8	Terminal No-hit
ContigView(URL based/DAS)	1	r	146042726	146082596	26	98.7	Both No-hit
ContigView(URL based/DAS)	1	f	146827464	147023143	27	96.6	Both No-hit

Primer_f	: TCATTGTCTTCTTCAGGTGGC
Primer_r	: GTAACCGTCTTGATCCATAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1245

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information