HUGE

Gene/Protein Characteristic Table for KIAA0454

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05601
Accession No. :	AB007923
Description :	phosphodiesterase 4D interacting protein isoform 3.
HUGO Gene Name :
Clone Name :	bf02274 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00502, former representative clones for KIAA0454 with bf02274. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8018 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1030 bp

Genome contig ID gi89161185r_143462785
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AAAATGTGTATAAAGAAATAAATAGTTTTTCTTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGCTTTGTTTCCCATTTCTGCACCAATCCCTTGACAGTATAAAGAACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 143562785 143751231 46 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2296 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001146341	99.0	phosphodiestera...	Pan troglodytes
CAH72528	99.9	phosphodiestera...	Homo sapiens
Q5VU43	92.2	Myomegalin; Pho...	Homo sapiens
CAH72523	92.2	phosphodiestera...	Homo sapiens
CAD91152	91.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007946	6e-127	97.9	KIAA0477
AB046853	6e-11	24.7	KIAA1633
AB040945	1.6e-06	22.5	KIAA1512
AB020673	2.5e-06	22.0	KIAA0866
AB007914	1.7e-05	23.5	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012943 137 199 PF07989 Spindle associated

IPR010630 1568 1638 PF06758 Protein of unknown function DUF1220

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012943	137	199	PF07989	Spindle associated
IPR010630	1568	1638	PF06758	Protein of unknown function DUF1220

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAACACATTCTACCAGCACTG
Primer_r	: CTTATCTCGGGGAAATTGCAG
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1030 bp
Genome contig ID	gi89161185r_143462785
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAAATGTGTATAAAGAAATAAATAGTTTTTCTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGCTTTGTTTCCCATTTCTGCACCAATCCCTTGACAGTATAAAGAACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	143562785	143751231	46	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0454

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information