HUGE

Gene/Protein Characteristic Table for KIAA1633

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04518
Accession No. :	AB046853
Description :	CDK5 regulatory subunit-associated protein 2.
HUGO Gene Name :
Clone Name :	fh23696 [Vector Info]
Flexi ORF Clone :	pF1KA1633
Source :	Human fetal brain
Note :	We replaced fh19672, former representative clones for KIAA1633 with fh23696. (2004/6/03)

Features of the cloned DNA sequence	Description

Length: 5966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 360 bp

Genome contig ID gi89161216r_122090975
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TTTGAAGATTCTCATTAAATGATTCATTTCATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTTGACGATTCTGTTGTTTTGTGTGGCGCCTCAAAGCCCAGGTCCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 122190975 122382238 37 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1852 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW87459	100.0	CDK5 regulatory...	Homo sapiens
NP_001011649	99.9	CDK5 regulatory...	Homo sapiens
AAI43763	99.9	CDK5 regulatory...	Homo sapiens
CAD97828	99.5	hypothetical pr...	Homo sapiens
EAW87463	95.8	CDK5 regulatory...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007923	5.3e-11	24.8	KIAA0454
AB020673	4.9e-05	21.8	KIAA0866
AB007946	0.0001	21.3	KIAA0477
AB023166	0.00021	22.6	KIAA0949

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012943 108 170 PF07989 Spindle associated

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012943	108	170	PF07989	Spindle associated

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	360 bp
Genome contig ID	gi89161216r_122090975
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TTTGAAGATTCTCATTAAATGATTCATTTCATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTGACGATTCTGTTGTTTTGTGTGGCGCCTCAAAGCCCAGGTCCCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	122190975	122382238	37	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1633

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information