HUGE |
Gene/Protein Characteristic Table for KIAA1633 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK04518 |
---|---|
Accession No. : | AB046853 |
Description : | CDK5 regulatory subunit-associated protein 2. |
HUGO Gene Name : | |
Clone Name : | fh23696 [Vector Info] |
Flexi ORF Clone : | pF1KA1633
![]() |
Source : | Human fetal brain |
Note : | We replaced fh19672, former representative clones for KIAA1633 with fh23696. (2004/6/03) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5966 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 360 bp Genome contig ID gi89161216r_122090975 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
TTTGAAGATTCTCATTAAATGATTCATTTCATTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCTTGACGATTCTGTTGTTTTGTGTGGCGCCTCAAAGCCCAGGTCCCAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 122190975 122382238 37 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1852 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 9 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |