HUGE |
Gene/Protein Characteristic Table for KIAA0949 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00156 |
---|---|
Accession No. : | AB023166 |
Description : | Citron Rho-interacting kinase. |
HUGO Gene Name : | citron (rho-interacting, serine/threonine kinase 21) (CIT) |
Clone Name : | af07325 [Vector Info] |
Flexi ORF Clone : | pF1KA0949
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced hj05069, former representative clones for KIAA0949 with af07325. (1999/6/16) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8516 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2438 bp Genome contig ID gi89161190r_118507981 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGAACAATTAGTGAAATAAAGCAATGATCTAAACTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGTGTGCTTTAGTGCAATGACCTCTTCTTTTTTTGAGAGACTGTGAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 118607981 118726665 39 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1559 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 12 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |