HUGE |
Gene/Protein Characteristic Table for KIAA1693 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06105 |
---|---|
Accession No. : | AB051480 |
Description : | Neuroblastoma breakpoint family member 10. |
HUGO Gene Name : | neuroblastoma breakpoint family, member 1 (NBPF1) |
Clone Name : | fj10588 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4239 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1531 bp Genome contig ID gi89161185f_143906782 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTAAAAGCTTTTGCCTCTAGATCGCGGGCGGCCGCFlanking genome sequence
(1127476 - 1127427) ----+----*----+----*----+----*----+----*----+----*
AACTTATATTCCAAAGATCTTTTTTATTTTAATTTTTTAAATTTGTTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 143326610 143541655 20 96.4 Terminal No-hit ContigView(URL based/DAS) 1 f 144004887 144081552 21 96.7 Terminal No-hit ContigView(URL based/DAS) 1 f 147006309 147024822 15 96.5 Terminal No-hit ContigView(URL based/DAS) 1 f 146844224 146862778 15 96.0 Terminal No-hit ContigView(URL based/DAS) 1 r 16761513 16784621 18 99.5 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 901 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CATGTCTCTGAGCTTCTATAC | |
: GTGTTACAGATGGATCAGCTA | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |