HUGE

Gene/Protein Characteristic Table for KIAA1283

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB033109
Description :	C3 and PZP-like, alpha-2-macroglobulin domain containing 8.
HUGO Gene Name :	C3 and PZP-like, alpha-2-macroglobulin domain containing 8 (CPAMD8)
Clone Name :	hh05359 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5815 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 161 bp

Genome contig ID gi42406306r_16764928
PolyA signal sequence
(AATACA,-30)
+----*----+----*----+----*----+----
ACACGAATACACGTTACTGATCTTACTCACATGTT
Flanking genome sequence
(99830 - 99781)
----+----*----+----*----+----*----+----*----+----*
CTGGGGTGCACATGAACTTTGTGTGTGCATGTGTGTGTGTGTGCATGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 16864758 16998450 42 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1884 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZJ3	100.0	C3 and PZP-like...	Homo sapiens
EAW84567	99.8	C3 and PZP-like...	Homo sapiens
NP_056507	99.8	C3 and PZP-like...	Homo sapiens
EAW84568	99.8	C3 and PZP-like...	Homo sapiens
XP_609516	85.2	similar to C3 a...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002890 15 289 PF01835 Alpha-2-macroglobulin

IPR011625 450 628 PF07703 Alpha-2-macroglobulin

IPR001599 749 844 PF00207 Alpha-2-macroglobulin

IPR011626 1181 1430 PF07678 A-macroglobulin complement component

IPR011627 1568 1658 PF07677 A-macroglobulin receptor

IPR002350 1711 1743 PF00050 Proteinase inhibitor I1

HMMSmart IPR002350 1710 1755 SM00280 Proteinase inhibitor I1

ScanRegExp IPR001599 1140 1148 PS00477 Alpha-2-macroglobulin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002890	15	289	PF01835	Alpha-2-macroglobulin
IPR011625	450	628	PF07703	Alpha-2-macroglobulin
IPR001599	749	844	PF00207	Alpha-2-macroglobulin
IPR011626	1181	1430	PF07678	A-macroglobulin complement component
IPR011627	1568	1658	PF07677	A-macroglobulin receptor
IPR002350	1711	1743	PF00050	Proteinase inhibitor I1
HMMSmart	IPR002350	1710	1755	SM00280	Proteinase inhibitor I1
ScanRegExp	IPR001599	1140	1148	PS00477	Alpha-2-macroglobulin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1 SGALLWPLLPLLLLLLSARDGVR 23 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	SGALLWPLLPLLLLLLSARDGVR	23	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCACCGTCTCTCCAAATCTG

Primer_r
: CCATTCTCCCAACACAGGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCACCGTCTCTCCAAATCTG
Primer_r	: CCATTCTCCCAACACAGGCTG
PCR product length	: 165 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	161 bp
Genome contig ID	gi42406306r_16764928
PolyA signal sequence (AATACA,-30)	+--------+--------+----*----+---- ACACGAATACACGTTACTGATCTTACTCACATGTT
Flanking genome sequence (99830 - 99781)	----+--------+--------+--------+--------+----* CTGGGGTGCACATGAACTTTGTGTGTGCATGTGTGTGTGTGTGCATGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	16864758	16998450	42	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1283

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information