HUGE |
Gene/Protein Characteristic Table for KIAA1297 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06960 |
---|---|
Accession No. : | AB037718 |
Description : | Striated muscle preferentially expressed protein kinase. |
HUGO Gene Name : | SPEG complex locus (SPEG) |
Clone Name : | fg03883 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6726 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 0 bp Genome contig ID gi89161199f_219940202 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CTGTCTGCCACAAGGAAATAAAAATGGCAAGCAGCFlanking genome sequence
(126394 - 126443) ----+----*----+----*----+----*----+----*----+----*
ATAACCTGTGTGTCTATTGGGAGGGATGGCTGGAGGGGAAGATGGCTGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 220040202 220066594 32 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2242 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGTGACAGGTTCCGGTATTC | |
: TTGTCTGGCTTGATGTCTAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: GeneBridge 4 | |
: GGCATCCCCGACTGTTACTAC | |
: TGAGTACCCCTGACAAAGACC | |
: 137 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |