HUGE

Gene/Protein Characteristic Table for KIAA1298

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06991
Accession No. :	AB037719
Description :	Protein phosphatase Slingshot homolog 1.
HUGO Gene Name :	slingshot homolog 1 (Drosophila) (SSH1)
Clone Name :	fg04206 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5463 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3191 bp

Genome contig ID gi89161190r_107602702
PolyA signal sequence
(TATAAA,-21)
+----*----+----*----+----*----+----
AGCTTGATACTCTTTATAAAAAACAGCTGAATCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTTCTGCCTCACATTAATTCATGTGGCATGCCAAAAGTTAGACTGAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 107702702 107723083 5 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 738 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW97832	100.0	slingshot homol...	Homo sapiens
EAW97830	98.0	slingshot homol...	Homo sapiens
AAH62341	98.0	Slingshot homol...	Homo sapiens
Q8WYL5	98.0	Protein phospha...	Homo sapiens
BAB84114	97.8	hSSH-1L [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051512	6.9e-10	25.7	KIAA1725

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000340 23 135 PF00782 Protein-tyrosine phosphatase

HMMSmart IPR000340 1 135 SM00195 Protein-tyrosine phosphatase

ProfileScan IPR000340 12 137 PS50054 Protein-tyrosine phosphatase

IPR000387 59 116 PS50056 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000340	23	135	PF00782	Protein-tyrosine phosphatase
HMMSmart	IPR000340	1	135	SM00195	Protein-tyrosine phosphatase
ProfileScan	IPR000340	12	137	PS50054	Protein-tyrosine phosphatase
IPR000387	59	116	PS50056	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATTGCTCAAGTGTCTGGCTC

Primer_r
: AACAGGAAGCAGTAATCTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3191 bp
Genome contig ID	gi89161190r_107602702
PolyA signal sequence (TATAAA,-21)	+--------+--------+----*----+---- AGCTTGATACTCTTTATAAAAAACAGCTGAATCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTCTGCCTCACATTAATTCATGTGGCATGCCAAAAGTTAGACTGAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	107702702	107723083	5	99.2	Perfect prediction

Primer_f	: AATTGCTCAAGTGTCTGGCTC
Primer_r	: AACAGGAAGCAGTAATCTCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1298

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information