HUGE

Gene/Protein Characteristic Table for KIAA1725

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06992
Accession No. :	AB051512
Description :	Protein phosphatase Slingshot homolog 2.
HUGO Gene Name :	slingshot homolog 2 (Drosophila) (SSH2)
Clone Name :	pf00950 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 8024 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4894 bp

Genome contig ID gi51511734r_24877091
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TGTTCTTGTTACAGATTGAATAAATTTTTATTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGATGAAACGTGTACTTCATCAGATGCAACAAAGGAGGGAGGTGCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 24977091 24999491 3 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1042 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q76I76	100.0	Protein phospha...	Homo sapiens
EAW51211	100.0	slingshot homol...	Homo sapiens
BAG59076	99.8	unnamed protein...	Homo sapiens
XP_511379	98.8	slingshot 2 [Pa...	Pan troglodytes
XP_001111396	96.4	similar to slin...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037719	3.1e-14	25.7	KIAA1298
AB051487	0.00067	27.2	KIAA1700

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000340 1 64 PF00782 Protein-tyrosine phosphatase

ProfileScan IPR000387 1 45 PS50056 Protein-tyrosine phosphatase

IPR000340 1 66 PS50054 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000340	1	64	PF00782	Protein-tyrosine phosphatase
ProfileScan	IPR000387	1	45	PS50056	Protein-tyrosine phosphatase
IPR000340	1	66	PS50054	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTGTACCCTGTGCTGTTGC

Primer_r
: CCTCCTCACATTGGTTCATAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: ATGTGTACCCTGTGCTGTTGC
Primer_r	: CCTCCTCACATTGGTTCATAC
PCR product length	: 131 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4894 bp
Genome contig ID	gi51511734r_24877091
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGTTCTTGTTACAGATTGAATAAATTTTTATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGATGAAACGTGTACTTCATCAGATGCAACAAAGGAGGGAGGTGCTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	24977091	24999491	3	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1725

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information