HUGE

Gene/Protein Characteristic Table for KIAA1700

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04839
Accession No. :	AB051487
Description :	Dual specificity protein phosphatase 16.
HUGO Gene Name :	dual specificity phosphatase 16 (DUSP16)
Clone Name :	fj15353 [Vector Info]
Flexi ORF Clone :	pF1KA1700
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2609 bp

Genome contig ID gi89161190r_12418424
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
TTAAATAAAATCAAAACTGGTACCTGTTTATACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATACGAGAAAAGACCTATCTTTGCAGCCATAAACTCGGTGGGAACACC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 12518424 12565482 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 690 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BY84	100.0	Dual specificit...	Homo sapiens
BAB71060	99.8	unnamed protein...	Homo sapiens
AAI09235	99.8	Dual specificit...	Homo sapiens
XP_520751	99.4	dual specificit...	Pan troglodytes
AAH42101	99.5	DUSP16 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037719	3.4e-05	31.7	KIAA1298
AB051512	0.00095	27.2	KIAA1725

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR008343 52 62 PR01764 MAP kinase phosphatase

IPR008343 77 89 PR01764 MAP kinase phosphatase

IPR008343 210 220 PR01764 MAP kinase phosphatase

IPR008343 231 240 PR01764 MAP kinase phosphatase

IPR008343 247 259 PR01764 MAP kinase phosphatase

HMMPfam IPR001763 36 156 PF00581 Rhodanese-like

IPR000340 183 322 PF00782 Protein-tyrosine phosphatase

HMMSmart IPR001763 37 159 SM00450 Rhodanese-like

IPR000340 183 322 SM00195 Protein-tyrosine phosphatase

ProfileScan IPR001763 47 162 PS50206 Rhodanese-like

IPR000340 183 324 PS50054 Protein-tyrosine phosphatase

IPR000387 252 306 PS50056 Protein-tyrosine phosphatase

ScanRegExp IPR000387 267 279 PS00383 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008343	52	62	PR01764	MAP kinase phosphatase
IPR008343	77	89	PR01764	MAP kinase phosphatase
IPR008343	210	220	PR01764	MAP kinase phosphatase
IPR008343	231	240	PR01764	MAP kinase phosphatase
IPR008343	247	259	PR01764	MAP kinase phosphatase
HMMPfam	IPR001763	36	156	PF00581	Rhodanese-like
IPR000340	183	322	PF00782	Protein-tyrosine phosphatase
HMMSmart	IPR001763	37	159	SM00450	Rhodanese-like
IPR000340	183	322	SM00195	Protein-tyrosine phosphatase
ProfileScan	IPR001763	47	162	PS50206	Rhodanese-like
IPR000340	183	324	PS50054	Protein-tyrosine phosphatase
IPR000387	252	306	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	267	279	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTCTTCAGCATGTAATTGGG

Primer_r
: TTCAACAGCTGGCCTTACTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2609 bp
Genome contig ID	gi89161190r_12418424
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- TTAAATAAAATCAAAACTGGTACCTGTTTATACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATACGAGAAAAGACCTATCTTTGCAGCCATAAACTCGGTGGGAACACC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	12518424	12565482	6	99.2	Perfect prediction

Primer_f	: TCTCTTCAGCATGTAATTGGG
Primer_r	: TTCAACAGCTGGCCTTACTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1700

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information