HUGE |
Gene/Protein Characteristic Table for KIAA1323 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05981 |
---|---|
Accession No. : | AB037744 |
Description : | E3 ubiquitin-protein ligase MIB1. |
HUGO Gene Name : | mindbomb homolog 1 (Drosophila) (MIB1) |
Clone Name : | fh13878 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5356 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4164 bp Genome contig ID gi51511735f_17572324 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
GTACTTCTTTAAAACATTAAATTTGAGGAAACTTTFlanking genome sequence
(130454 - 130503) ----+----*----+----*----+----*----+----*----+----*
AATGCTGTCTCGTGTACATTGCTTTACTACAGTGAGGGGGAATATCCTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 17672324 17702776 10 99.5 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 396 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATTGCTGTTTGTCCACTCTG | |
: TCTGTTGTAACCCCACTGTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: GeneBridge 4 | |
: AATTGCTGTTTGTCCACTCTG | |
: TCTGTTGTAACCCCACTGTCC | |
: 120 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |