HUGE

Gene/Protein Characteristic Table for KIAA1323

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05981
Accession No. :	AB037744
Description :	E3 ubiquitin-protein ligase MIB1.
HUGO Gene Name :	mindbomb homolog 1 (Drosophila) (MIB1)
Clone Name :	fh13878 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4164 bp

Genome contig ID gi51511735f_17572324
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
GTACTTCTTTAAAACATTAAATTTGAGGAAACTTT
Flanking genome sequence
(130454 - 130503)
----+----*----+----*----+----*----+----*----+----*
AATGCTGTCTCGTGTACATTGCTTTACTACAGTGAGGGGGAATATCCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 17672324 17702776 10 99.5 Internal No-hit

Features of the protein sequence	Description

Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG52320	2.5e-157	100.0	unnamed protein...	Homo sapiens
CAH18429	2.5e-157	100.0	hypothetical pr...	Homo sapiens
EAX01132	2.7e-157	100.0	mindbomb homolo...	Homo sapiens
AAN18023	2.9e-157	100.0	MINDBOMB; ubiqu...	Homo sapiens
XP_001092086	2.9e-157	100.0	similar to mind...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023174	2.5e-07	32.0	KIAA0957
AB058779	0.00053	26.0	KIAA1876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 22 34 PR01415 Ankyrin

IPR002110 68 80 PR01415 Ankyrin

HMMPfam IPR002110 21 54 PF00023 Ankyrin

IPR002110 55 87 PF00023 Ankyrin

IPR002110 88 161 PF00023 Ankyrin

IPR001841 353 385 PF00097 Zinc finger

HMMSmart IPR002110 21 51 SM00248 Ankyrin

IPR002110 55 84 SM00248 Ankyrin

IPR002110 88 119 SM00248 Ankyrin

IPR001841 209 243 SM00184 Zinc finger

IPR001841 256 290 SM00184 Zinc finger

IPR001841 353 385 SM00184 Zinc finger

ProfileScan IPR002110 21 45 PS50088 Ankyrin

IPR002110 21 169 PS50297 Ankyrin

IPR002110 55 87 PS50088 Ankyrin

IPR001841 209 244 PS50089 Zinc finger

IPR001841 256 291 PS50089 Zinc finger

IPR001841 353 386 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	22	34	PR01415	Ankyrin
IPR002110	68	80	PR01415	Ankyrin
HMMPfam	IPR002110	21	54	PF00023	Ankyrin
IPR002110	55	87	PF00023	Ankyrin
IPR002110	88	161	PF00023	Ankyrin
IPR001841	353	385	PF00097	Zinc finger
HMMSmart	IPR002110	21	51	SM00248	Ankyrin
IPR002110	55	84	SM00248	Ankyrin
IPR002110	88	119	SM00248	Ankyrin
IPR001841	209	243	SM00184	Zinc finger
IPR001841	256	290	SM00184	Zinc finger
IPR001841	353	385	SM00184	Zinc finger
ProfileScan	IPR002110	21	45	PS50088	Ankyrin
IPR002110	21	169	PS50297	Ankyrin
IPR002110	55	87	PS50088	Ankyrin
IPR001841	209	244	PS50089	Zinc finger
IPR001841	256	291	PS50089	Zinc finger
IPR001841	353	386	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATTGCTGTTTGTCCACTCTG

Primer_r
: TCTGTTGTAACCCCACTGTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AATTGCTGTTTGTCCACTCTG
Primer_r	: TCTGTTGTAACCCCACTGTCC
PCR product length	: 120 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4164 bp
Genome contig ID	gi51511735f_17572324
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTACTTCTTTAAAACATTAAATTTGAGGAAACTTT
Flanking genome sequence (130454 - 130503)	----+--------+--------+--------+--------+----* AATGCTGTCTCGTGTACATTGCTTTACTACAGTGAGGGGGAATATCCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	17672324	17702776	10	99.5	Internal No-hit

Gene/Protein Characteristic Table for KIAA1323

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information