HUGE

Gene/Protein Characteristic Table for KIAA1339

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07466
Accession No. :	AB037760
Description :	Zinc finger protein 398.
HUGO Gene Name :	zinc finger protein 398 (ZNF398)
Clone Name :	fj00071 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2987 bp

Genome contig ID gi89161213f_148404531
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTGTGAAAATAAATGGAAGTTGGTTGATTGTCTAG
Flanking genome sequence
(106289 - 106338)
----+----*----+----*----+----*----+----*----+----*
AAAGTGCAAGAAGATGGCCCTGCTCCTTTTCTGCTGAACATTTAGTATTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 148504531 148510818 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 409 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAK92788	2e-163	100.0	zinc finger DNA...	Homo sapiens
BAF83188	2.6e-163	100.0	unnamed protein...	Homo sapiens
Q8TD17	2.6e-163	100.0	Zinc finger pro...	Homo sapiens
EAW80060	2.6e-163	100.0	zinc finger pro...	Homo sapiens
BAG63321	2.6e-163	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002324	2.9e-31	44.2	KIAA0326
AB075836	1e-30	43.8	KIAA1956
AB051497	2.9e-30	42.7	KIAA1710
AB040941	2.9e-29	43.5	KIAA1508
AB058755	3.1e-29	39.9	KIAA1852

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 278 301 PD000003 Zinc finger

IPR007087 306 329 PD000003 Zinc finger

HMMPfam IPR007087 165 187 PF00096 Zinc finger

IPR007087 194 216 PF00096 Zinc finger

IPR007087 222 244 PF00096 Zinc finger

IPR007087 250 272 PF00096 Zinc finger

IPR007087 278 300 PF00096 Zinc finger

IPR007087 306 328 PF00096 Zinc finger

IPR007087 334 357 PF00096 Zinc finger

HMMSmart IPR015880 110 131 SM00355 Zinc finger

IPR015880 165 187 SM00355 Zinc finger

IPR015880 194 216 SM00355 Zinc finger

IPR015880 222 244 SM00355 Zinc finger

IPR015880 250 272 SM00355 Zinc finger

IPR015880 278 300 SM00355 Zinc finger

IPR015880 306 328 SM00355 Zinc finger

IPR015880 334 357 SM00355 Zinc finger

ProfileScan IPR007087 137 164 PS50157 Zinc finger

IPR007087 165 192 PS50157 Zinc finger

IPR007087 194 221 PS50157 Zinc finger

IPR007087 222 249 PS50157 Zinc finger

IPR007087 250 277 PS50157 Zinc finger

IPR007087 278 305 PS50157 Zinc finger

IPR007087 306 333 PS50157 Zinc finger

IPR007087 334 359 PS50157 Zinc finger

ScanRegExp IPR007087 167 187 PS00028 Zinc finger

IPR007087 196 216 PS00028 Zinc finger

IPR007087 224 244 PS00028 Zinc finger

IPR007087 252 272 PS00028 Zinc finger

IPR007087 280 300 PS00028 Zinc finger

IPR007087 308 328 PS00028 Zinc finger

IPR007087 336 357 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	278	301	PD000003	Zinc finger
IPR007087	306	329	PD000003	Zinc finger
HMMPfam	IPR007087	165	187	PF00096	Zinc finger
IPR007087	194	216	PF00096	Zinc finger
IPR007087	222	244	PF00096	Zinc finger
IPR007087	250	272	PF00096	Zinc finger
IPR007087	278	300	PF00096	Zinc finger
IPR007087	306	328	PF00096	Zinc finger
IPR007087	334	357	PF00096	Zinc finger
HMMSmart	IPR015880	110	131	SM00355	Zinc finger
IPR015880	165	187	SM00355	Zinc finger
IPR015880	194	216	SM00355	Zinc finger
IPR015880	222	244	SM00355	Zinc finger
IPR015880	250	272	SM00355	Zinc finger
IPR015880	278	300	SM00355	Zinc finger
IPR015880	306	328	SM00355	Zinc finger
IPR015880	334	357	SM00355	Zinc finger
ProfileScan	IPR007087	137	164	PS50157	Zinc finger
IPR007087	165	192	PS50157	Zinc finger
IPR007087	194	221	PS50157	Zinc finger
IPR007087	222	249	PS50157	Zinc finger
IPR007087	250	277	PS50157	Zinc finger
IPR007087	278	305	PS50157	Zinc finger
IPR007087	306	333	PS50157	Zinc finger
IPR007087	334	359	PS50157	Zinc finger
ScanRegExp	IPR007087	167	187	PS00028	Zinc finger
IPR007087	196	216	PS00028	Zinc finger
IPR007087	224	244	PS00028	Zinc finger
IPR007087	252	272	PS00028	Zinc finger
IPR007087	280	300	PS00028	Zinc finger
IPR007087	308	328	PS00028	Zinc finger
IPR007087	336	357	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGCGATACTAAGCCTCAGCC

Primer_r
: CACTCTTTGGAACTGGCCTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGCGATACTAAGCCTCAGCC
Primer_r	: CACTCTTTGGAACTGGCCTGC
PCR product length	: 105 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2987 bp
Genome contig ID	gi89161213f_148404531
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTGTGAAAATAAATGGAAGTTGGTTGATTGTCTAG
Flanking genome sequence (106289 - 106338)	----+--------+--------+--------+--------+----* AAAGTGCAAGAAGATGGCCCTGCTCCTTTTCTGCTGAACATTTAGTATTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	148504531	148510818	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1339

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information