HUGE

Gene/Protein Characteristic Table for KIAA1359

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06064
Accession No. :	AB037780
Description :	Transmembrane mucin MUC20S.
HUGO Gene Name :	mucin 20, cell surface associated (MUC20)
Clone Name :	fj02042 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3550 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 202 bp

Genome contig ID gi89161205f_196835382
PolyA signal sequence
(AAGAAA,-28)
+----*----+----*----+----*----+----
AGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGG
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 196935382 197031160 4 98.5 Terminal No-hit

Features of the protein sequence	Description

Length: 517 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD06720	1.7e-142	99.0	transmembrane m...	Homo sapiens
Q8N307	1.4e-103	80.7	Mucin-20; Short...	Homo sapiens
CAH89437	3.3e-86	85.3	hypothetical pr...	Pongo abelii
NP_001091986	9.4e-84	88.3	mucin 20 isofor...	Homo sapiens
NP_689886	1e-83	88.0	mucin 20 isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79992	0.00047	25.0	KIAA0170
AB002307	0.00065	25.9	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTTCACCCCTTCAGAGACAC

Primer_r
: TGCTGTTGGTTGTAGTCGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTTCACCCCTTCAGAGACAC
Primer_r	: TGCTGTTGGTTGTAGTCGGAG
PCR product length	: 105 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	202 bp
Genome contig ID	gi89161205f_196835382
PolyA signal sequence (AAGAAA,-28)	+--------+--------+----*----+---- AGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGG
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	196935382	197031160	4	98.5	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1359

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information