HUGE |
Gene/Protein Characteristic Table for KIAA1359 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06064 |
---|---|
Accession No. : | AB037780 |
Description : | Transmembrane mucin MUC20S. |
HUGO Gene Name : | mucin 20, cell surface associated (MUC20) |
Clone Name : | fj02042 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3550 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 202 bp Genome contig ID gi89161205f_196835382 PolyA signal sequence
(AAGAAA,-28) +----*----+----*----+----*----+----
AGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 196935382 197031160 4 98.5 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 517 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACTTCACCCCTTCAGAGACAC | |
: TGCTGTTGGTTGTAGTCGGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: ACTTCACCCCTTCAGAGACAC | |
: TGCTGTTGGTTGTAGTCGGAG | |
: 105 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |