HUGE

Gene/Protein Characteristic Table for KIAA1365

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05881
Accession No. :	AB037786
Description :	Leucine-rich repeat-containing protein 7.
HUGO Gene Name :	leucine rich repeat containing 7 (LRRC7)
Clone Name :	fj02517 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4150 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1594 bp

Genome contig ID gi89161185f_70174429
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TATTTTTGTAGGGTCTATTAAAATGAGTGTCACTT
Flanking genome sequence
(187325 - 187374)
----+----*----+----*----+----*----+----*----+----*
ATTAGAAGTACAGTGGTATTTTTTGGCAATAGAATTTGTCACTTGGGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 70274429 70361752 8 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 831 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH70975	99.8	leucine rich re...	Homo sapiens
EAX06461	99.8	leucine rich re...	Homo sapiens
Q80TE7	93.3	Leucine-rich re...	Mus musculus
EDL11847	93.3	mCG11661 [Mus m...	Mus musculus
P70587	93.1	Leucine-rich re...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033051	9.6e-13	32.3	KIAA1225

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 742 826 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 749 829 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 744 829 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	742	826	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	749	829	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	744	829	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACTGTAGCCCCTGTGATTTC

Primer_r
: CTTTCTAACAGCAGTCTTTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACTGTAGCCCCTGTGATTTC
Primer_r	: CTTTCTAACAGCAGTCTTTCG
PCR product length	: 144 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1594 bp
Genome contig ID	gi89161185f_70174429
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TATTTTTGTAGGGTCTATTAAAATGAGTGTCACTT
Flanking genome sequence (187325 - 187374)	----+--------+--------+--------+--------+----* ATTAGAAGTACAGTGGTATTTTTTGGCAATAGAATTTGTCACTTGGGAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	70274429	70361752	8	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1365

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information