HUGE

Gene/Protein Characteristic Table for KIAA1427

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00829
Accession No. :	AB037848
Description :	Synaptotagmin-13.
HUGO Gene Name :	synaptotagmin XIII (SYT13)
Clone Name :	fh02770 [Vector Info]
Flexi ORF Clone :	pF1KSDA1427
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5145 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3752 bp

Genome contig ID gi51511727r_45118428
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CCTTGCAGTGGTAAATAAAAAATTTCCAACAGGGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CAGCTGCCTGGTGTTTTCTTTTTTTCCGTTTTACCTAATATTTTGGCATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 45218428 45264446 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 439 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001104396	6.4e-176	98.2	similar to syna...	Macaca mulatta
Q7L8C5	2.5e-175	100.0	Synaptotagmin-1...	Homo sapiens
XP_521898	1.5e-174	99.5	hypothetical pr...	Pan troglodytes
XP_540764	3.9e-163	91.1	similar to syna...	Canis lupus fam...
AAI40519	1.5e-161	92.3	SYT13 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38522	2.1e-15	25.7	KIAA0080
AB037763	2.6e-14	26.1	KIAA1342
AB023202	4.4e-06	23.9	KIAA0985

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 202 272 PF00168 C2 calcium-dependent membrane targeting

IPR000008 317 407 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR000008 316 432 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000008 314 407 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	202	272	PF00168	C2 calcium-dependent membrane targeting
IPR000008	317	407	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	316	432	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	314	407	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGGATTCTGCCTTTGGACCC

Primer_r
: ATAAGGCTCCTGCTCAGATTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3752 bp
Genome contig ID	gi51511727r_45118428
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCTTGCAGTGGTAAATAAAAAATTTCCAACAGGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAGCTGCCTGGTGTTTTCTTTTTTTCCGTTTTACCTAATATTTTGGCATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	45218428	45264446	6	99.2	Perfect prediction

Primer_f	: ATGGATTCTGCCTTTGGACCC
Primer_r	: ATAAGGCTCCTGCTCAGATTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1427

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information