HUGE

Gene/Protein Characteristic Table for KIAA1439

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00836
Accession No. :	AB037860
Description :	Nuclear factor 1 A-type.
HUGO Gene Name :	nuclear factor I/A (NFIA)
Clone Name :	hg01641b [Vector Info]
Flexi ORF Clone :	pF1KSDA1439
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3063 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1049 bp

Genome contig ID gi89161185f_61220568
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TATTGTTAAACTTGTATCCCTTTAAAAACTGAAGG
Flanking genome sequence
(474063 - 474112)
----+----*----+----*----+----*----+----*----+----*
AAATTAAAAAAAAAAAACAAAAAAACAAATCTAATGGTGCTTTTACCACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 61320568 61694629 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 561 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG61515	8.1e-150	99.2	unnamed protein...	Homo sapiens
EDL30906	1.1e-148	95.9	nuclear factor ...	Mus musculus
Q12857	4.7e-146	100.0	Nuclear factor ...	Homo sapiens
P09414	7e-146	99.8	Nuclear factor ...	Rattus norvegicus
BAG61351	1.1e-145	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003619 117 224 PF03165 MAD homology 1

IPR000647 266 561 PF00859 CTF/NF-I

HMMSmart IPR003619 119 227 SM00523 MAD homology 1

ProfileScan IPR000647 53 246 PS51080 CTF/NF-I

ScanRegExp IPR000647 88 99 PS00349 CTF/NF-I

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003619	117	224	PF03165	MAD homology 1
IPR000647	266	561	PF00859	CTF/NF-I
HMMSmart	IPR003619	119	227	SM00523	MAD homology 1
ProfileScan	IPR000647	53	246	PS51080	CTF/NF-I
ScanRegExp	IPR000647	88	99	PS00349	CTF/NF-I

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATATCCCTCAACAGACACAG

Primer_r
: CGCTGATAGTGAAGTTGTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1049 bp
Genome contig ID	gi89161185f_61220568
PolyA signal sequence (None)	+--------+--------+----*----+---- TATTGTTAAACTTGTATCCCTTTAAAAACTGAAGG
Flanking genome sequence (474063 - 474112)	----+--------+--------+--------+--------+----* AAATTAAAAAAAAAAAACAAAAAAACAAATCTAATGGTGCTTTTACCACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	61320568	61694629	11	100.0	Perfect prediction

Primer_f	: AATATCCCTCAACAGACACAG
Primer_r	: CGCTGATAGTGAAGTTGTAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1439

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information