HUGE

Gene/Protein Characteristic Table for KIAA1443

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00839
Accession No. :	AB037864
Description :	Homeobox and leucine zipper protein Homez.
HUGO Gene Name :
Clone Name :	hj01820b [Vector Info]
Flexi ORF Clone :	pF1KSDA1443
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3239 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1515 bp

Genome contig ID gi51511730r_22713109
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TAAAATGCTAGAATAATAATAAAAAGGCCAAAAAT
Flanking genome sequence
(211893 - 211844)
----+----*----+----*----+----*----+----*----+----*
GCGGGTGCAGCTGCTGCATTCCCAGGTGAGGGGGTCAGGAGCCACCTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 22811186 22825076 3 98.2 Terminal No-hit

Features of the protein sequence	Description

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001150591	2.9e-176	98.6	homeodomain leu...	Pan troglodytes
XP_001102279	4.3e-172	97.0	similar to home...	Macaca mulatta
BAG10069	2e-171	100.0	homeobox and le...	synthetic construct
BAG59479	3.3e-170	99.6	unnamed protein...	Homo sapiens
BAG63992	1.2e-165	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001356 383 437 PF00046 Homeobox

HMMSmart IPR001356 79 141 SM00389 Homeobox

IPR001356 380 442 SM00389 Homeobox

ProfileScan IPR001356 94 133 PS50071 Homeobox

IPR001356 378 438 PS50071 Homeobox

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001356	383	437	PF00046	Homeobox
HMMSmart	IPR001356	79	141	SM00389	Homeobox
IPR001356	380	442	SM00389	Homeobox
ProfileScan	IPR001356	94	133	PS50071	Homeobox
IPR001356	378	438	PS50071	Homeobox

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTGTTAACTACCTCCTGTCC

Primer_r
: ATTTGCCATATAGCTGATCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTGTTAACTACCTCCTGTCC
Primer_r	: ATTTGCCATATAGCTGATCCC
PCR product length	: 196 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1515 bp
Genome contig ID	gi51511730r_22713109
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TAAAATGCTAGAATAATAATAAAAAGGCCAAAAAT
Flanking genome sequence (211893 - 211844)	----+--------+--------+--------+--------+----* GCGGGTGCAGCTGCTGCATTCCCAGGTGAGGGGGTCAGGAGCCACCTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	22811186	22825076	3	98.2	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1443

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information