HUGE |
Gene/Protein Characteristic Table for KIAA1443 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00839 |
---|---|
Accession No. : | AB037864 |
Description : | Homeobox and leucine zipper protein Homez. |
HUGO Gene Name : | |
Clone Name : | hj01820b [Vector Info] |
Flexi ORF Clone : | pF1KSDA1443
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3239 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1515 bp Genome contig ID gi51511730r_22713109 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TAAAATGCTAGAATAATAATAAAAAGGCCAAAAATFlanking genome sequence
(211893 - 211844) ----+----*----+----*----+----*----+----*----+----*
GCGGGTGCAGCTGCTGCATTCCCAGGTGAGGGGGTCAGGAGCCACCTTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 22811186 22825076 3 98.2 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 573 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCTGTTAACTACCTCCTGTCC | |
: ATTTGCCATATAGCTGATCCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: CCTGTTAACTACCTCCTGTCC | |
: ATTTGCCATATAGCTGATCCC | |
: 196 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |