HUGE |
Gene/Protein Characteristic Table for KIAA1479 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00847 |
---|---|
Accession No. : | AB040912 |
Description : | Semaphorin-6D precursor. |
HUGO Gene Name : | sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D (SEMA6D) |
Clone Name : | fh17949 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1479
![]() |
Source : | Human fetal brain |
Note : | We replaced fj05577, former representative clones for KIAA1479 with fh17949. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5924 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2437 bp Genome contig ID gi51511731f_45163695 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CGCATGTAAAGTCAAAATAAAATATACAAATCATTFlanking genome sequence
(690016 - 690065) ----+----*----+----*----+----*----+----*----+----*
ATATCCTGCCTCTTGATATTGAAGAGGTTTATAACATGTTATATTTTTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 45263695 45853709 18 99.4 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1022 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGTTAATATGCTGCACACCAC | |
: CTGGTCTTCTGCAACATGTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |