HUGE

Gene/Protein Characteristic Table for KIAA1483

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07398
Accession No. :	AB040916
Description :	Zinc finger and BTB domain-containing protein 2.
HUGO Gene Name :	zinc finger and BTB domain containing 2 (ZBTB2)
Clone Name :	fj06303 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 2692 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1403 bp

Genome contig ID gi89161210r_151626945
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CATCCTTTCATTGAATAAACGTTTAATTAAATGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATATGATGTCATGTCATCTCTGCGTCTTTGTCTACCCAAAGAGATACAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 151726945 151729637 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 428 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW47752	6.4e-148	99.8	zinc finger and...	Homo sapiens
CAH56321	6.6e-148	99.8	hypothetical pr...	Homo sapiens
Q8N680	7.3e-148	99.8	Zinc finger and...	Homo sapiens
XP_001136407	1.2e-147	99.3	zinc finger and...	Pan troglodytes
XP_527539	1.4e-147	99.3	zinc finger and...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095924	0.00017	26.4	KIAA2003
AB014528	0.00028	28.3	KIAA0628
AB033024	0.00038	30.4	KIAA1198
AB002324	0.00039	24.4	KIAA0326
AB037852	0.00044	27.9	KIAA1431

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 168 190 PF00096 Zinc finger

IPR007087 277 299 PF00096 Zinc finger

HMMSmart IPR015880 168 190 SM00355 Zinc finger

IPR015880 277 299 SM00355 Zinc finger

IPR015880 304 324 SM00355 Zinc finger

ProfileScan IPR007087 168 192 PS50157 Zinc finger

IPR007087 277 304 PS50157 Zinc finger

ScanRegExp IPR007087 170 190 PS00028 Zinc finger

IPR007087 279 299 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	168	190	PF00096	Zinc finger
IPR007087	277	299	PF00096	Zinc finger
HMMSmart	IPR015880	168	190	SM00355	Zinc finger
IPR015880	277	299	SM00355	Zinc finger
IPR015880	304	324	SM00355	Zinc finger
ProfileScan	IPR007087	168	192	PS50157	Zinc finger
IPR007087	277	304	PS50157	Zinc finger
ScanRegExp	IPR007087	170	190	PS00028	Zinc finger
IPR007087	279	299	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGGCAAAGAGAAATCAGGAC

Primer_r
: TTACTGCTTTCGGGCCAATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1403 bp
Genome contig ID	gi89161210r_151626945
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CATCCTTTCATTGAATAAACGTTTAATTAAATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATATGATGTCATGTCATCTCTGCGTCTTTGTCTACCCAAAGAGATACAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	151726945	151729637	1	99.0	Perfect prediction

Primer_f	: ATGGCAAAGAGAAATCAGGAC
Primer_r	: TTACTGCTTTCGGGCCAATGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1483

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information