| HUGE |
Gene/Protein Characteristic Table for KIAA1485 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07417 |
|---|---|
| Accession No. : | AB040918 |
| Description : | Zinc finger protein 406. |
| HUGO Gene Name : | zinc finger and AT hook domain containing (ZFAT) |
| Clone Name : | fj07037 [Vector Info] |
| Flexi ORF Clone : | pF1KA1485
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4006 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 690 bp Genome contig ID gi51511724r_135459217 PolyA signal sequence
(AATAAA,-19)
GAGGTGAGGTGGTTGGAATAAAAACAGTTCCTGTCFlanking genome sequence
(100000 - 99951)
TGAATGCTTTGGTTCTTCAGGCGGGATGGCTTACATTTCCCCTTCCCAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 r 135559217 135718917 14 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1104 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : GTACGGGTTTTTAATCACTGC | |
| : CTTAGAATGGGAGGCGAACAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 8 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
