HUGE |
Gene/Protein Characteristic Table for KIAA1513 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB040946 |
Description : | Pogo transposable element with KRAB domain. |
HUGO Gene Name : | pogo transposable element with KRAB domain (POGK) |
Clone Name : | fh00168 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5498 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 3774 bp Genome contig ID gi89161185f_164975348 PolyA signal sequence
(AAGAAA,-8) +----*----+----*----+----*----+----
GGTGACAGAGTGAGACCCTATCTCAAAAAGAAAAGFlanking genome sequence
(116859 - 116908) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAAATGGCATACCTTAGTTGGAATCTGCTTTTTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 165075348 165092205 6 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 649 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTGGTGGACAGAGTTCAGATG | |
: ATAGAATGCTGGAAGACTGCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |