HUGE |
Gene/Protein Characteristic Table for KIAA1535 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05401 |
---|---|
Accession No. : | AB040968 |
Description : | Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3. |
HUGO Gene Name : | hyperpolarization activated cyclic nucleotide-gated potassium channel 3 (HCN3) |
Clone Name : | fk12792 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh09002, former representative clones for KIAA1535 with fk12792. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3522 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1384 bp Genome contig ID gi89161185f_153414193 PolyA signal sequence
(TATAAA,-18) +----*----+----*----+----*----+----
AAACAGCTGGGTTTAAATATAAAATAGACACACTCFlanking genome sequence
(112071 - 112120) ----+----*----+----*----+----*----+----*----+----*
ATTTTTGGCTCTTGGTTTGTGTGTGGGAACAACATGAGTGGGAAGGAATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 153514193 153526262 8 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 711 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTCTGAGTTTGCTGTTGGTG | |
: TGGTCCCACAGTCTTTAATGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CTTCTGAGTTTGCTGTTGGTG | |
: TGGTCCCACAGTCTTTAATGC | |
: 171 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |