HUGE

Gene/Protein Characteristic Table for KIAA1550

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06405
Accession No. :	AB046770
Description :	Plexin-A4 precursor.
HUGO Gene Name :	plexin A4 (PLXNA4)
Clone Name :	ff03434 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh16159 and fh16159s1, former representative clones for KIAA1550 with ff03434. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 11518 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 7127 bp

Genome contig ID gi89161213r_131358640
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
ATAGAATAAAGTTTATTAAAAAATAATAAAAATGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTTGGGATTTTGGGTGCTTCTTTATGTGACTGGCTAGGAGGGGCTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 131458640 131824667 30 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1462 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCM2	100.0	Plexin-A4; Flag...	Homo sapiens
XP_519389	99.5	plexin A4, A is...	Pan troglodytes
XP_001136153	99.6	plexin A4, A is...	Pan troglodytes
XP_001498318	98.6	plexin A4 [Equu...	Equus caballus
XP_001135989	98.4	plexin A4, A is...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007932	0	70.8	KIAA0463
AB033032	1.7e-85	35.6	KIAA1206
AB002313	6.9e-56	35.4	KIAA0315
AB014520	5.4e-50	36.1	KIAA0620
AB007867	1.2e-43	32.6	KIAA0407

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001627 1 58 PF01403 Semaphorin/CD100 antigen

IPR002165 77 127 PF01437 Plexin

IPR002165 223 270 PF01437 Plexin

IPR002165 371 424 PF01437 Plexin

IPR002909 426 519 PF01833 Cell surface receptor IPT/TIG

IPR002909 522 604 PF01833 Cell surface receptor IPT/TIG

IPR002909 608 706 PF01833 Cell surface receptor IPT/TIG

IPR002909 710 797 PF01833 Cell surface receptor IPT/TIG

IPR013548 878 1432 PF08337 Plexin cytoplasmic region

HMMSmart IPR003659 77 127 SM00423 Plexin/semaphorin/integrin

IPR003659 223 270 SM00423 Plexin/semaphorin/integrin

IPR003659 371 424 SM00423 Plexin/semaphorin/integrin

IPR002909 425 519 SM00429 Cell surface receptor IPT/TIG

IPR002909 521 605 SM00429 Cell surface receptor IPT/TIG

IPR002909 607 707 SM00429 Cell surface receptor IPT/TIG

IPR002909 709 798 SM00429 Cell surface receptor IPT/TIG

ProfileScan IPR001627 1 75 PS51004 Semaphorin/CD100 antigen

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	1	58	PF01403	Semaphorin/CD100 antigen
IPR002165	77	127	PF01437	Plexin
IPR002165	223	270	PF01437	Plexin
IPR002165	371	424	PF01437	Plexin
IPR002909	426	519	PF01833	Cell surface receptor IPT/TIG
IPR002909	522	604	PF01833	Cell surface receptor IPT/TIG
IPR002909	608	706	PF01833	Cell surface receptor IPT/TIG
IPR002909	710	797	PF01833	Cell surface receptor IPT/TIG
IPR013548	878	1432	PF08337	Plexin cytoplasmic region
HMMSmart	IPR003659	77	127	SM00423	Plexin/semaphorin/integrin
IPR003659	223	270	SM00423	Plexin/semaphorin/integrin
IPR003659	371	424	SM00423	Plexin/semaphorin/integrin
IPR002909	425	519	SM00429	Cell surface receptor IPT/TIG
IPR002909	521	605	SM00429	Cell surface receptor IPT/TIG
IPR002909	607	707	SM00429	Cell surface receptor IPT/TIG
IPR002909	709	798	SM00429	Cell surface receptor IPT/TIG
ProfileScan	IPR001627	1	75	PS51004	Semaphorin/CD100 antigen

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 805 PAIVSIAVAGGLLIIFIVAVLIA 827 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	805	PAIVSIAVAGGLLIIFIVAVLIA	827	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTAGAGATGAAGGTGTCGGTG

Primer_r
: ATCTGGGGGTTCTGTATGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: CCR
Primer_f	: CTAGAGATGAAGGTGTCGGTG
Primer_r	: ATCTGGGGGTTCTGTATGAGG
PCR product length	: 176(2k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	7127 bp
Genome contig ID	gi89161213r_131358640
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- ATAGAATAAAGTTTATTAAAAAATAATAAAAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTTGGGATTTTGGGTGCTTCTTTATGTGACTGGCTAGGAGGGGCTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	131458640	131824667	30	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1550

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information