HUGE |
Gene/Protein Characteristic Table for KIAA1714 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01178 |
---|---|
Accession No. : | AB051501 |
Description : | Contactin-associated protein-like 3 precursor. |
HUGO Gene Name : | contactin associated protein-like 3 (CNTNAP3) |
Clone Name : | fj19060y1 [Vector Info] |
Flexi ORF Clone : | pF1KA1714
![]() |
Source : | Human fetal brain |
Note : | We replaced fj19060, former representative clones for KIAA1714 with fj19060y1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5248 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1718 bp Genome contig ID gi89161216r_38974974 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
CATCTTTGTTTCCTTCCAAATAAAGGAGAACATGGFlanking genome sequence
(99995 - 99946) ----+----*----+----*----+----*----+----*----+----*
AATTGAAGGTGTTAATGTTTTCATTCAAGGATGGTATATTCAAAGGCATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 39074969 40623428 21 99.0 Perfect prediction ContigView(URL based/DAS) 9 f 43625145 43849289 20 97.9 Perfect prediction ContigView(URL based/DAS) 9 f 65316728 65390684 12 97.6 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1175 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TACCTTTCAGTTATCCTCGCC | |
: GTTTGACTTCTGCATTTGTGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: CCR | |
: TACCTTTCAGTTATCCTCGCC | |
: GTTTGACTTCTGCATTTGTGG | |
: 189(1.6k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |