HUGE

Gene/Protein Characteristic Table for KIAA1763

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07719
Accession No. :	AB051550
Description :	Contactin-associated protein-like 4 precursor.
HUGO Gene Name :	contactin associated protein-like 4 (CNTNAP4)
Clone Name :	fj06918y2 [Vector Info]
Flexi ORF Clone :	pF1KA1763
Source :	Human fetal brain
Note :	We replaced fj06918 and fj06918y1, former representative clones for KIAA1763 with fj06918y2. (2003/4/2,2008/8/27)

Features of the cloned DNA sequence	Description

Length: 4692 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 380 bp

Genome contig ID gi51511732f_74768677
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATTAAATTTGGACTATAATGTCCTTGCTTTATTTG
Flanking genome sequence
(381786 - 381835)
----+----*----+----*----+----*----+----*----+----*
AGAACATTTGCTGTGTTTGCTTTTGTCTCCTCGTGGTGTTATTCATAGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 74868677 75150461 24 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1322 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC55272	100.0	hypothetical pr...	Homo sapiens
EAW95610	99.9	contactin assoc...	Homo sapiens
Q9C0A0	99.8	Contactin-assoc...	Homo sapiens
XP_001143566	99.2	cell recognitio...	Pan troglodytes
XP_001104635	97.4	cell recognitio...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051501	0	72.3	KIAA1714
AB020675	0	48.4	KIAA0868
AB023138	2.2e-24	26.0	KIAA0921
AB018286	2.7e-24	24.3	KIAA0743
AB011150	6.3e-23	25.1	KIAA0578

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000421 57 188 PF00754 Coagulation factor 5/8 type

IPR012680 226 355 PF02210 Laminin G

IPR012680 412 538 PF02210 Laminin G

IPR006209 567 599 PF00008 EGF-like

IPR012680 835 954 PF02210 Laminin G

IPR006209 976 1010 PF00008 EGF-like

IPR012680 1060 1190 PF02210 Laminin G

HMMSmart IPR000421 44 191 SM00231 Coagulation factor 5/8 type

IPR001791 218 355 SM00282 Laminin G

IPR001791 404 538 SM00282 Laminin G

IPR006210 566 600 SM00181 EGF

IPR001791 827 954 SM00282 Laminin G

IPR006210 975 1011 SM00181 EGF

IPR001791 1052 1190 SM00282 Laminin G

ProfileScan IPR000421 45 191 PS50022 Coagulation factor 5/8 type

IPR001791 197 378 PS50025 Laminin G

IPR001791 384 561 PS50025 Laminin G

IPR000742 563 600 PS50026 EGF-like

IPR001791 807 972 PS50025 Laminin G

IPR000742 973 1011 PS50026 EGF-like

IPR001791 1023 1216 PS50025 Laminin G

ScanRegExp IPR000421 83 112 PS01285 Coagulation factor 5/8 type

IPR000421 173 191 PS01286 Coagulation factor 5/8 type

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000421	57	188	PF00754	Coagulation factor 5/8 type
IPR012680	226	355	PF02210	Laminin G
IPR012680	412	538	PF02210	Laminin G
IPR006209	567	599	PF00008	EGF-like
IPR012680	835	954	PF02210	Laminin G
IPR006209	976	1010	PF00008	EGF-like
IPR012680	1060	1190	PF02210	Laminin G
HMMSmart	IPR000421	44	191	SM00231	Coagulation factor 5/8 type
IPR001791	218	355	SM00282	Laminin G
IPR001791	404	538	SM00282	Laminin G
IPR006210	566	600	SM00181	EGF
IPR001791	827	954	SM00282	Laminin G
IPR006210	975	1011	SM00181	EGF
IPR001791	1052	1190	SM00282	Laminin G
ProfileScan	IPR000421	45	191	PS50022	Coagulation factor 5/8 type
IPR001791	197	378	PS50025	Laminin G
IPR001791	384	561	PS50025	Laminin G
IPR000742	563	600	PS50026	EGF-like
IPR001791	807	972	PS50025	Laminin G
IPR000742	973	1011	PS50026	EGF-like
IPR001791	1023	1216	PS50025	Laminin G
ScanRegExp	IPR000421	83	112	PS01285	Coagulation factor 5/8 type
IPR000421	173	191	PS01286	Coagulation factor 5/8 type

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 14 NMGSVTGAVLKTLLLLSTQNWN 35 SECONDARY 22

2 1254 SAVIGGLIAVVIFILLCITAIAV 1276 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	14	NMGSVTGAVLKTLLLLSTQNWN	35	SECONDARY	22
2	1254	SAVIGGLIAVVIFILLCITAIAV	1276	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: CCR
Primer_f	: CCTCGTCCAGTGATATATTTC
Primer_r	: GACCAAGGCTACAGTTTTCAC
PCR product length	: 152 bp
PCR conditions	: 95 °C15 sec62 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	380 bp
Genome contig ID	gi51511732f_74768677
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTAAATTTGGACTATAATGTCCTTGCTTTATTTG
Flanking genome sequence (381786 - 381835)	----+--------+--------+--------+--------+----* AGAACATTTGCTGTGTTTGCTTTTGTCTCCTCGTGGTGTTATTCATAGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	74868677	75150461	24	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1763

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information