| HUGE |
Gene/Protein Characteristic Table for KIAA0868 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04596 |
|---|---|
| Accession No. : | AB020675 |
| Description : | Contactin-associated protein-like 2 precursor. |
| HUGO Gene Name : | contactin associated protein-like 2 (CNTNAP2) |
| Clone Name : | hk06919 [Vector Info] |
| Flexi ORF Clone : | pF1KA0868
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4185 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 164 bp Genome contig ID gi89161213f_145344877 PolyA signal sequence
(AATATA,-31)
ATGGAATATAATGGAATATTCTTGAGACTGATCACFlanking genome sequence
(2398930 - 2398979)
AAAAAAAAAAACCTTTTTAATATTTCTTTATAGCTGAGTTTTCCCTTCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 146167734 147743805 18 99.9 Both No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1339 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TAATCCAGGACAAGGCCAAGC | |
| : GGTCTCTGTGAAGTTGGGGTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 7 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
