HUGE

Gene/Protein Characteristic Table for KIAA1993

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00966
Accession No. :	AB082524
Description :	Zinc finger and BTB domain-containing protein 34.
HUGO Gene Name :	zinc finger and BTB domain containing 34 (ZBTB34)
Clone Name :	bg00180 [Vector Info]
Flexi ORF Clone :	pF1KSDA1993
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6545 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4945 bp

Genome contig ID gi89161216f_128581487
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
ATAAATAAAGTCAATGGACATTGCTGTTTGTAAAT
Flanking genome sequence
(106473 - 106522)
----+----*----+----*----+----*----+----*----+----*
AAAAATGCTGCTAGAGCAAATGTGCTGTGGTCTCCCTCTGCGTGGGCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 128662765 128687958 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 532 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001142000	1.1e-213	99.6	zinc finger and...	Pan troglodytes
Q8NCN2	4.5e-202	100.0	Zinc finger and...	Homo sapiens
XP_548452	8.3e-201	98.6	similar to Zinc...	Canis lupus fam...
AAI60177	1.2e-200	100.0	Zinc finger and...	synthetic construct
XP_001917307	1.2e-196	98.0	zinc finger and...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007874	6.1e-21	30.4	KIAA0414
AB007901	6.6e-11	25.7	KIAA0441
AB046792	7.8e-09	26.9	KIAA1572
AB075836	4.5e-08	52.0	KIAA1956
AB023141	5.1e-08	32.1	KIAA0924

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 54 158 PF00651 BTB/POZ

IPR007087 404 426 PF00096 Zinc finger

IPR007087 432 454 PF00096 Zinc finger

IPR007087 460 483 PF00096 Zinc finger

HMMSmart IPR000210 64 158 SM00225 BTB/POZ-like

IPR015880 404 426 SM00355 Zinc finger

IPR015880 432 454 SM00355 Zinc finger

IPR015880 460 483 SM00355 Zinc finger

ProfileScan IPR000210 64 128 PS50097 BTB/POZ-like

IPR007087 404 431 PS50157 Zinc finger

IPR007087 432 459 PS50157 Zinc finger

IPR007087 460 488 PS50157 Zinc finger

ScanRegExp IPR007087 406 426 PS00028 Zinc finger

IPR007087 434 454 PS00028 Zinc finger

IPR007087 462 483 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	54	158	PF00651	BTB/POZ
IPR007087	404	426	PF00096	Zinc finger
IPR007087	432	454	PF00096	Zinc finger
IPR007087	460	483	PF00096	Zinc finger
HMMSmart	IPR000210	64	158	SM00225	BTB/POZ-like
IPR015880	404	426	SM00355	Zinc finger
IPR015880	432	454	SM00355	Zinc finger
IPR015880	460	483	SM00355	Zinc finger
ProfileScan	IPR000210	64	128	PS50097	BTB/POZ-like
IPR007087	404	431	PS50157	Zinc finger
IPR007087	432	459	PS50157	Zinc finger
IPR007087	460	488	PS50157	Zinc finger
ScanRegExp	IPR007087	406	426	PS00028	Zinc finger
IPR007087	434	454	PS00028	Zinc finger
IPR007087	462	483	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGAGTAATTCCAGCCCATCC

Primer_r
: GGTTGTTCATCATGGCTTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4945 bp
Genome contig ID	gi89161216f_128581487
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- ATAAATAAAGTCAATGGACATTGCTGTTTGTAAAT
Flanking genome sequence (106473 - 106522)	----+--------+--------+--------+--------+----* AAAAATGCTGCTAGAGCAAATGTGCTGTGGTCTCCCTCTGCGTGGGCCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	128662765	128687958	2	99.0	Perfect prediction

Primer_f	: TTGAGTAATTCCAGCCCATCC
Primer_r	: GGTTGTTCATCATGGCTTCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1993

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information