HUGE

Gene/Protein Characteristic Table for KIAA2035

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07404
Accession No. :	AB111887
Description :	Zinc finger CCCH domain-containing protein 6.
HUGO Gene Name :	zinc finger CCCH-type containing 6 (ZC3H6)
Clone Name :	ff09201 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 10939 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 7529 bp

Genome contig ID gi89161199f_112677275
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TCTATTGTCTGAATTTAAATAAAAATGTTTCTAAT
Flanking genome sequence
(136832 - 136881)
----+----*----+----*----+----*----+----*----+----*
AATATCTGTCTGGCAGTGTGATGCTTTGCTTTAATAAATCTTCAGCATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 112774025 112814105 12 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P61129	100.0	Zinc finger CCC...	Homo sapiens
NP_940983	100.0	zinc finger CCC...	Homo sapiens
XP_525863	98.9	zinc finger CCC...	Pan troglodytes
XP_001087547	98.0	zinc finger CCC...	Macaca mulatta
XP_001495641	89.5	zinc finger CCC...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028987	1.6e-20	34.1	KIAA1064

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000571 219 244 PF00642 Zinc finger

IPR000571 248 273 PF00642 Zinc finger

IPR000571 275 297 PF00642 Zinc finger

HMMSmart IPR000571 219 244 SM00356 Zinc finger

IPR000571 248 273 SM00356 Zinc finger

IPR000571 274 297 SM00356 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	219	244	PF00642	Zinc finger
IPR000571	248	273	PF00642	Zinc finger
IPR000571	275	297	PF00642	Zinc finger
HMMSmart	IPR000571	219	244	SM00356	Zinc finger
IPR000571	248	273	SM00356	Zinc finger
IPR000571	274	297	SM00356	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	7529 bp
Genome contig ID	gi89161199f_112677275
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCTATTGTCTGAATTTAAATAAAAATGTTTCTAAT
Flanking genome sequence (136832 - 136881)	----+--------+--------+--------+--------+----* AATATCTGTCTGGCAGTGTGATGCTTTGCTTTAATAAATCTTCAGCATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	112774025	112814105	12	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA2035

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information