HUGE

Gene/Protein Characteristic Table for KIAA1064

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01623
Accession No. :	AB028987
Description :	Zinc finger CCCH domain-containing protein C19orf7.
HUGO Gene Name :	zinc finger CCCH-type containing 4 (ZC3H4)
Clone Name :	hj05008s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1064
Source :	Human adult brain
Note :	We replaced hj05008, former representative clones for KIAA1064 with hj05008s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6115 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2165 bp

Genome contig ID gi42406306r_52159289
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ATTGTATTACTGCCATTAAAGGATGCAGTTATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAGCTTGTGGGTCTGGTCTCTCCAGGCTGCCCCAGACCATCCCTTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 52259289 52308849 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPT8	100.0	Zinc finger CCC...	Homo sapiens
XP_001109916	98.5	similar to Zinc...	Macaca mulatta
XP_599954	92.8	similar to zinc...	Bos taurus
Q6ZPZ3	90.7	Zinc finger CCC...	Mus musculus
XP_001053214	90.1	similar to Zinc...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111887	1.1e-17	34.0	KIAA2035
AB032998	0.00094	23.8	KIAA1172

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000571 403 428 PF00642 Zinc finger

IPR000571 432 457 PF00642 Zinc finger

IPR000571 459 481 PF00642 Zinc finger

HMMSmart IPR000571 403 428 SM00356 Zinc finger

IPR000571 432 457 SM00356 Zinc finger

IPR000571 458 481 SM00356 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	403	428	PF00642	Zinc finger
IPR000571	432	457	PF00642	Zinc finger
IPR000571	459	481	PF00642	Zinc finger
HMMSmart	IPR000571	403	428	SM00356	Zinc finger
IPR000571	432	457	SM00356	Zinc finger
IPR000571	458	481	SM00356	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAAGTTCTGGTCAGTGTGGC

Primer_r
: GTTCAATACCTTCCCAGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2165 bp
Genome contig ID	gi42406306r_52159289
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATTGTATTACTGCCATTAAAGGATGCAGTTATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGCTTGTGGGTCTGGTCTCTCCAGGCTGCCCCAGACCATCCCTTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	52259289	52308849	15	99.3	Perfect prediction

Primer_f	: TTAAGTTCTGGTCAGTGTGGC
Primer_r	: GTTCAATACCTTCCCAGACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1064

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information