HUGE |
Gene/Protein Characteristic Table for KIAA2036 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK07687 |
---|---|
Accession No. : | AB111888 |
Description : | SCO-spondin homolog (Fragment). |
HUGO Gene Name : | |
Clone Name : | pf06513 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7480 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2399 bp Genome contig ID gi89161213f_149014241 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATGGGATACATTATAATTTCATTCTCAGTCTGGTTFlanking genome sequence
(112864 - 112913) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGGCTGTCTTTGAATGCATCTCTTGCCAGAAAATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 149114241 149127103 22 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1322 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 7 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |