Order Kazusa clone(s) from : ![]() |
Product ID | ORK00384 |
---|---|
Accession No | D28588 |
Description | Sp2 transcription factor |
Clone name | ha01311 |
Vector information | |
cDNA sequence | DNA sequence (3288 bp) Predicted protein sequence (627 aa) |
Flexi ORF Clone | FXC00384 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0048
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1133 bp |
---|---|
Genome contig ID | gi51511734f_43229973 |
PolyA signal sequence (AATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (131349 - 131398) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 43329973 | 43361320 | 7 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 569 | 594 | PD000003 | Zinc finger |
IPR007087 | 599 | 621 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 539 | 563 | PF00096 | Zinc finger |
IPR007087 | 569 | 593 | PF00096 | Zinc finger | |
IPR007087 | 599 | 621 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 539 | 563 | SM00355 | Zinc finger |
IPR015880 | 569 | 593 | SM00355 | Zinc finger | |
IPR015880 | 599 | 621 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 539 | 568 | PS50157 | Zinc finger |
IPR007087 | 569 | 598 | PS50157 | Zinc finger | |
IPR007087 | 599 | 626 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 541 | 563 | PS00028 | Zinc finger |
IPR007087 | 571 | 593 | PS00028 | Zinc finger | |
IPR007087 | 601 | 621 | PS00028 | Zinc finger |
Panel name | Stanford G3 |
---|---|
Primer_f | TTCCTTTCCTTGTTATTCACC |
Primer_r | AGGTGCTGTTATCTGAATCCA |
PCR product length | 151 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |