Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07451 |
---|---|
Accession No | AB095928 |
Description | zinc finger protein 266, transcript variant 2 |
Clone name | fj01689 |
Vector information | |
cDNA sequence | DNA sequence (4400 bp) Predicted protein sequence (580 aa) |
HaloTag ORF Clone |
FHC07451
|
Flexi ORF Clone | FXC07451 |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 243 | 266 | PD000003 | Zinc finger |
IPR007087 | 271 | 294 | PD000003 | Zinc finger | |
IPR007087 | 299 | 321 | PD000003 | Zinc finger | |
IPR007087 | 327 | 350 | PD000003 | Zinc finger | |
IPR007087 | 355 | 378 | PD000003 | Zinc finger | |
IPR007087 | 383 | 406 | PD000003 | Zinc finger | |
IPR007087 | 411 | 434 | PD000003 | Zinc finger | |
IPR007087 | 439 | 462 | PD000003 | Zinc finger | |
IPR007087 | 467 | 490 | PD000003 | Zinc finger | |
IPR007087 | 523 | 546 | PD000003 | Zinc finger | |
IPR007087 | 551 | 573 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 3 | 43 | PF01352 | KRAB box |
IPR007087 | 243 | 265 | PF00096 | Zinc finger | |
IPR007087 | 271 | 293 | PF00096 | Zinc finger | |
IPR007087 | 299 | 321 | PF00096 | Zinc finger | |
IPR007087 | 327 | 349 | PF00096 | Zinc finger | |
IPR007087 | 355 | 377 | PF00096 | Zinc finger | |
IPR007087 | 383 | 405 | PF00096 | Zinc finger | |
IPR007087 | 411 | 433 | PF00096 | Zinc finger | |
IPR007087 | 439 | 461 | PF00096 | Zinc finger | |
IPR007087 | 467 | 489 | PF00096 | Zinc finger | |
IPR007087 | 495 | 517 | PF00096 | Zinc finger | |
IPR007087 | 523 | 545 | PF00096 | Zinc finger | |
IPR007087 | 551 | 573 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 3 | 63 | SM00349 | KRAB box |
IPR015880 | 187 | 209 | SM00355 | Zinc finger | |
IPR015880 | 243 | 265 | SM00355 | Zinc finger | |
IPR015880 | 271 | 293 | SM00355 | Zinc finger | |
IPR015880 | 299 | 321 | SM00355 | Zinc finger | |
IPR015880 | 327 | 349 | SM00355 | Zinc finger | |
IPR003656 | 340 | 380 | SM00614 | Zinc finger | |
IPR015880 | 355 | 377 | SM00355 | Zinc finger | |
IPR015880 | 383 | 405 | SM00355 | Zinc finger | |
IPR015880 | 411 | 433 | SM00355 | Zinc finger | |
IPR015880 | 439 | 461 | SM00355 | Zinc finger | |
IPR003656 | 452 | 492 | SM00614 | Zinc finger | |
IPR015880 | 467 | 489 | SM00355 | Zinc finger | |
IPR015880 | 495 | 517 | SM00355 | Zinc finger | |
IPR015880 | 523 | 545 | SM00355 | Zinc finger | |
IPR015880 | 551 | 573 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 3 | 73 | PS50805 | KRAB box |
IPR007087 | 187 | 214 | PS50157 | Zinc finger | |
IPR007087 | 215 | 242 | PS50157 | Zinc finger | |
IPR007087 | 243 | 270 | PS50157 | Zinc finger | |
IPR007087 | 271 | 298 | PS50157 | Zinc finger | |
IPR007087 | 299 | 326 | PS50157 | Zinc finger | |
IPR007087 | 327 | 354 | PS50157 | Zinc finger | |
IPR007087 | 355 | 382 | PS50157 | Zinc finger | |
IPR007087 | 383 | 410 | PS50157 | Zinc finger | |
IPR007087 | 411 | 438 | PS50157 | Zinc finger | |
IPR007087 | 439 | 466 | PS50157 | Zinc finger | |
IPR007087 | 467 | 494 | PS50157 | Zinc finger | |
IPR007087 | 495 | 522 | PS50157 | Zinc finger | |
IPR007087 | 523 | 550 | PS50157 | Zinc finger | |
IPR007087 | 551 | 578 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 245 | 265 | PS00028 | Zinc finger |
IPR007087 | 273 | 293 | PS00028 | Zinc finger | |
IPR007087 | 301 | 321 | PS00028 | Zinc finger | |
IPR007087 | 329 | 349 | PS00028 | Zinc finger | |
IPR007087 | 357 | 377 | PS00028 | Zinc finger | |
IPR007087 | 385 | 405 | PS00028 | Zinc finger | |
IPR007087 | 413 | 433 | PS00028 | Zinc finger | |
IPR007087 | 441 | 461 | PS00028 | Zinc finger | |
IPR007087 | 469 | 489 | PS00028 | Zinc finger | |
IPR007087 | 497 | 517 | PS00028 | Zinc finger | |
IPR007087 | 525 | 545 | PS00028 | Zinc finger | |
IPR007087 | 553 | 573 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | ATTAGTCTTCCCTCATGGTCC |
---|---|
Primer_r | GGCACTTCTTACACATGATTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |