Gene/Protein Characteristic Table for KIAA2007
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07451
Accession No AB095928
Description zinc finger protein 266, transcript variant 2
Clone name fj01689
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4400 bp)
Predicted protein sequence (580 aa)
Flexi ORF Clone FXC07451
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 4400 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 580 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001160876 0 99.0 zinc finger pro...
Pan troglodytes
XP_524100 0 98.9 zinc finger pro...
Pan troglodytes
AAH71628 2.3e-174 100.0 ZNF266 protein ...
Homo sapiens
XP_512350 2.4e-135 62.7 zinc finger pro...
Pan troglodytes
BAD93074 4.6e-134 62.5 zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037770 3.8e-70 48.4 KIAA1349
AB046831 2e-69 47.6 KIAA1611
AB107355 1.6e-64 37.8 KIAA2033
D31763 2e-64 38.9 KIAA0065
AB058755 8.7e-64 41.0 KIAA1852
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 243 266 PD000003 Zinc finger
IPR007087 271 294 PD000003 Zinc finger
IPR007087 299 321 PD000003 Zinc finger
IPR007087 327 350 PD000003 Zinc finger
IPR007087 355 378 PD000003 Zinc finger
IPR007087 383 406 PD000003 Zinc finger
IPR007087 411 434 PD000003 Zinc finger
IPR007087 439 462 PD000003 Zinc finger
IPR007087 467 490 PD000003 Zinc finger
IPR007087 523 546 PD000003 Zinc finger
IPR007087 551 573 PD000003 Zinc finger
HMMPfam IPR001909 3 43 PF01352 KRAB box
IPR007087 243 265 PF00096 Zinc finger
IPR007087 271 293 PF00096 Zinc finger
IPR007087 299 321 PF00096 Zinc finger
IPR007087 327 349 PF00096 Zinc finger
IPR007087 355 377 PF00096 Zinc finger
IPR007087 383 405 PF00096 Zinc finger
IPR007087 411 433 PF00096 Zinc finger
IPR007087 439 461 PF00096 Zinc finger
IPR007087 467 489 PF00096 Zinc finger
IPR007087 495 517 PF00096 Zinc finger
IPR007087 523 545 PF00096 Zinc finger
IPR007087 551 573 PF00096 Zinc finger
HMMSmart IPR001909 3 63 SM00349 KRAB box
IPR015880 187 209 SM00355 Zinc finger
IPR015880 243 265 SM00355 Zinc finger
IPR015880 271 293 SM00355 Zinc finger
IPR015880 299 321 SM00355 Zinc finger
IPR015880 327 349 SM00355 Zinc finger
IPR003656 340 380 SM00614 Zinc finger
IPR015880 355 377 SM00355 Zinc finger
IPR015880 383 405 SM00355 Zinc finger
IPR015880 411 433 SM00355 Zinc finger
IPR015880 439 461 SM00355 Zinc finger
IPR003656 452 492 SM00614 Zinc finger
IPR015880 467 489 SM00355 Zinc finger
IPR015880 495 517 SM00355 Zinc finger
IPR015880 523 545 SM00355 Zinc finger
IPR015880 551 573 SM00355 Zinc finger
ProfileScan IPR001909 3 73 PS50805 KRAB box
IPR007087 187 214 PS50157 Zinc finger
IPR007087 215 242 PS50157 Zinc finger
IPR007087 243 270 PS50157 Zinc finger
IPR007087 271 298 PS50157 Zinc finger
IPR007087 299 326 PS50157 Zinc finger
IPR007087 327 354 PS50157 Zinc finger
IPR007087 355 382 PS50157 Zinc finger
IPR007087 383 410 PS50157 Zinc finger
IPR007087 411 438 PS50157 Zinc finger
IPR007087 439 466 PS50157 Zinc finger
IPR007087 467 494 PS50157 Zinc finger
IPR007087 495 522 PS50157 Zinc finger
IPR007087 523 550 PS50157 Zinc finger
IPR007087 551 578 PS50157 Zinc finger
ScanRegExp IPR007087 245 265 PS00028 Zinc finger
IPR007087 273 293 PS00028 Zinc finger
IPR007087 301 321 PS00028 Zinc finger
IPR007087 329 349 PS00028 Zinc finger
IPR007087 357 377 PS00028 Zinc finger
IPR007087 385 405 PS00028 Zinc finger
IPR007087 413 433 PS00028 Zinc finger
IPR007087 441 461 PS00028 Zinc finger
IPR007087 469 489 PS00028 Zinc finger
IPR007087 497 517 PS00028 Zinc finger
IPR007087 525 545 PS00028 Zinc finger
IPR007087 553 573 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATTAGTCTTCCCTCATGGTCC
Primer_r GGCACTTCTTACACATGATTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp