KIAA0079

Product ID	ORK06755
Accession No	D38555
Description	SEC24 family member C
Clone name	ha03543
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4463 bp) Predicted protein sequence (1102 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0079 by Kazusa Mouse cDNA Project

Length: 4463 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1064 bp
Genome contig ID	gi89161187f_75076395
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- TTTAATTTGTAAAGAAATAAAATAAATTAAGATGT
Flanking genome sequence (125530 - 125579)	----+--------+--------+--------+--------+----* AACCATTAGCCTCATCTTTACTCCCGAAAGCTCACTTTGCTTTTAGTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	75176395	75201923	23	100.0	Perfect prediction

Length: 1102 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW54515	100.0	SEC24 related g...	Homo sapiens
P53992	99.9	Protein transpo...	Homo sapiens
XP_001145058	99.5	SEC24-related p...	Pan troglodytes
CAH92936	98.0	hypothetical pr...	Pongo abelii
CAH91410	97.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018298	8.2e-73	56.5	KIAA0755

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	143	252	PD026943	NULL
HMMPfam	IPR006895	429	468	PF04810	Zinc finger
	IPR006896	507	754	PF04811	Sec23/Sec24 trunk region
	IPR012990	756	840	PF08033	Sec23/Sec24 beta-sandwich
	IPR006900	852	955	PF04815	Sec23/Sec24 helical region
	IPR007123	969	1044	PF00626	Gelsolin region
ScanRegExp	IPR001360	988	996	PS00572	Glycoside hydrolase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GTTTCTCTGCTTTCACTGCTC
Primer_r	GAAATGAGAGGTCCAGAGCAG
PCR product length	479 bp
PCR conditions	95 °C15 sec65 °C120 sec35 cycles